ORK11470

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11470

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11470
Clone name	hc00370
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	UROD
cDNA sequence	DNA sequence (1128 bp) Predicted protein sequence (369 aa)
HaloTag ORF Clone	FHC11470
Flexi ORF Clone	FXC11470
Description	uroporphyrinogen decarboxylase

Features of the cloned cDNA sequence

Description

Length: 1128 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	17 bp
Genome contig ID	gi89161185f_45151165
PolyA signal sequence (None)	+--------+--------+----*----+---- CTGCTTCGACAGAACTGAGTGTATACCTTTACCCT
Flanking genome sequence (102611 - 102660)	----+--------+--------+--------+--------+----* CAAGTACCACTAACACAGATGATTGATCGTTTCCAGGACAATAAAAGTTT

Features of the protein sequence

Description

Length: 369 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P06132	1.1e-154	100.0	Uroporphyrinoge...	Homo sapiens
AAX37109	1.1e-154	100.0	uroporphyrinoge...	synthetic construct
1R3W	1.9e-154	99.7	Uroporphyrinoge...	Homo sapiens
XP_513127	2.3e-154	99.7	uroporphyrinoge...	Pan troglodytes
1R3R	2.6e-154	99.7	Uroporphyrinoge...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	3	19	PD870534	NULL
BlastProDom	IPR000257	20	360	PD003225	Uroporphyrinogen decarboxylase (URO-D)
HMMPfam	IPR000257	16	362	PF01208	Uroporphyrinogen decarboxylase (URO-D)
HMMTigr	IPR006361	20	361	TIGR01464	Uroporphyrinogen decarboxylase HemE
ScanRegExp	IPR000257	34	43	PS00906	Uroporphyrinogen decarboxylase (URO-D)
ScanRegExp	IPR000257	154	170	PS00907	Uroporphyrinogen decarboxylase (URO-D)

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp