ORK11525

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11525

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11525
Clone name	fh22735
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ANKS1B
cDNA sequence	DNA sequence (5264 bp) Predicted protein sequence (413 aa)
HaloTag ORF Clone	FHC11525
Flexi ORF Clone	FXC11525
Description	ankyrin repeat and sterile alpha motif domain containing 1B

Features of the cloned cDNA sequence

Description

Length: 5264 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4020 bp
Genome contig ID	gi89161190r_97548091
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TCTCCTAATAACTGAATAAAGATGTAGGTTAATGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACATTTTGTAAACAGAATTGTGTTTTCAATGAAACCTTGTAAAGGGATA

Features of the protein sequence

Description

Length: 413 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAF80756	3.1e-179	100.0	putative 47 kDa...	Homo sapiens
AAI42670	1.2e-178	99.7	Ankyrin repeat ...	Homo sapiens
AAV28691	7.8e-169	96.7	AIDA1C transcri...	Homo sapiens
BAC33978	2.7e-166	95.3	unnamed protein...	Mus musculus
AAP38184	7e-164	98.9	AIDA-1bDAnk [Ho...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	33	99	PF00536	Sterile alpha motif SAM
	IPR001660	107	172	PF00536	Sterile alpha motif SAM
	IPR006020	227	357	PF00640	Phosphotyrosine interaction region
HMMSmart	IPR001660	32	101	SM00454	Sterile alpha motif SAM
	IPR001660	106	174	SM00454	Sterile alpha motif SAM
	IPR006020	222	360	SM00462	Phosphotyrosine interaction region
ProfileScan	IPR001660	38	101	PS50105	Sterile alpha motif SAM
	IPR001660	109	168	PS50105	Sterile alpha motif SAM
	IPR006020	224	357	PS01179	Phosphotyrosine interaction region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp