ORK11546

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11546

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11546
Clone name	sj00362
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	WDR5B
cDNA sequence	DNA sequence (4147 bp) Predicted protein sequence (380 aa)
HaloTag ORF Clone	FHC11546
Flexi ORF Clone	FXC11546
Description	WD repeat domain 5B

Features of the cloned cDNA sequence

Description

Length: 4147 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2961 bp
Genome contig ID	gi89161205r_123513392
PolyA signal sequence (None)	+--------+--------+----*----+---- GCACTCTAGCCTGGGCGACAGTGCAAGACTGTCTC
Flanking genome sequence (99720 - 99671)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGGTTTCATTAAATTTAAGCTCATAAATGTTACTACA

Features of the protein sequence

Description

Length: 380 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q86VZ2	6.1e-144	100.0	WD repeat-conta...	Homo sapiens
XP_516691	1.1e-143	99.6	WD repeat domai...	Pan troglodytes
BAA92110	2.5e-143	99.6	unnamed protein...	Homo sapiens
Q5RE95	8.9e-143	99.0	WD repeat-conta...	Pongo abelii
XP_001112263	1.8e-141	97.5	similar to WD r...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	86	118	PD000018	WD40 repeat
	IPR001680	128	162	PD000018	WD40 repeat
	IPR001680	170	204	PD000018	WD40 repeat
	IPR001680	212	245	PD000018	WD40 repeat
	IPR001680	263	288	PD000018	WD40 repeat
	IPR001680	298	334	PD000018	WD40 repeat
	IPR001680	343	376	PD000018	WD40 repeat
FPrintScan	IPR001680	148	162	PR00320	WD40 repeat
	IPR001680	190	204	PR00320	WD40 repeat
	IPR001680	232	246	PR00320	WD40 repeat
HMMPfam	IPR001680	81	119	PF00400	WD40 repeat
	IPR001680	123	161	PF00400	WD40 repeat
	IPR001680	165	203	PF00400	WD40 repeat
	IPR001680	207	245	PF00400	WD40 repeat
	IPR001680	249	288	PF00400	WD40 repeat
	IPR001680	292	333	PF00400	WD40 repeat
	IPR001680	337	365	PF00400	WD40 repeat
HMMSmart	IPR001680	80	119	SM00320	WD40 repeat
	IPR001680	122	161	SM00320	WD40 repeat
	IPR001680	164	203	SM00320	WD40 repeat
	IPR001680	206	245	SM00320	WD40 repeat
	IPR001680	248	288	SM00320	WD40 repeat
	IPR001680	291	333	SM00320	WD40 repeat
	IPR001680	336	377	SM00320	WD40 repeat
ProfileScan	IPR001680	87	128	PS50082	WD40 repeat
	IPR001680	87	380	PS50294	WD40 repeat
	IPR001680	129	170	PS50082	WD40 repeat
	IPR001680	171	212	PS50082	WD40 repeat
	IPR001680	213	254	PS50082	WD40 repeat
	IPR001680	256	297	PS50082	WD40 repeat
	IPR001680	298	342	PS50082	WD40 repeat
ScanRegExp	IPR001680	148	162	PS00678	WD40 repeat
	IPR001680	190	204	PS00678	WD40 repeat
	IPR001680	232	246	PS00678	WD40 repeat
	IPR001680	320	334	PS00678	WD40 repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp