Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11559
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11559
Clone name bm00929
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CALB1
cDNA sequence DNA sequence (2517 bp)
Predicted protein sequence (286 aa)
Flexi ORF Clone FXC11559
Description calbindin 1, 28kDa
Features of the cloned cDNA sequence

Length: 2517 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1563 bp
Genome contig ID gi51511724r_91040014
PolyA signal sequence
(AATAAA,-21)		 
+----*----+----*----+----*----+----
AACTACTAAGAATAAATAAAGAAGAAAATAACCTT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AATCTCTTGTATTTGTTTTTTCTTCAAAATGTCAGCTGACATGCAATCTA

Features of the protein sequence

Length: 286 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P05937 6.6e-102 100.0 Calbindin; Vita...
 Homo sapiens
Q5R4V1 1.4e-101 99.6 Calbindin.
 Pongo abelii
BAE88767 6.1e-101 98.8 unnamed protein...
 Macaca fascicularis
XP_001488522 8.2e-101 98.4 calbindin-D28k ...
 Equus caballus
P04467 3.6e-100 98.4 Calbindin; Vita...
 Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR002048 126 196 PD000012 Calcium-binding EF-hand
IPR002048 214 253 PD000012 Calcium-binding EF-hand
HMMPfam IPR002048 40 68 PF00036 Calcium-binding EF-hand
IPR002048 127 155 PF00036 Calcium-binding EF-hand
IPR002048 171 199 PF00036 Calcium-binding EF-hand
IPR002048 215 243 PF00036 Calcium-binding EF-hand
HMMSmart IPR002048 40 68 SM00054 Calcium-binding EF-hand
IPR002048 127 155 SM00054 Calcium-binding EF-hand
IPR002048 171 199 SM00054 Calcium-binding EF-hand
IPR002048 215 243 SM00054 Calcium-binding EF-hand
ProfileScan IPR002048 36 71 PS50222 Calcium-binding EF-hand
IPR002048 78 113 PS50222 Calcium-binding EF-hand
IPR002048 123 158 PS50222 Calcium-binding EF-hand
IPR002048 167 202 PS50222 Calcium-binding EF-hand
IPR002048 211 246 PS50222 Calcium-binding EF-hand
ScanRegExp IPR002048 49 61 PS00018 Calcium-binding EF-hand
IPR002048 136 148 PS00018 Calcium-binding EF-hand
IPR002048 180 192 PS00018 Calcium-binding EF-hand
IPR002048 224 236 PS00018 Calcium-binding EF-hand
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp