Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11563
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11563
Clone name bm01145
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol SERPINH1
cDNA sequence DNA sequence (1812 bp)
Predicted protein sequence (438 aa)
Flexi ORF Clone FXC11563
Description serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)
Features of the cloned cDNA sequence

Length: 1812 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 493 bp
Genome contig ID gi51511727f_74855006
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CACCCCCAGAATGACCTGGCCGCAGTGAGGCGGAT
Flanking genome sequence
(106265 - 106314)
----+----*----+----*----+----*----+----*----+----*
TGAGAAGGAGCTCCCAGGAGGGGCTTCTGGGCAGACTCTGGTCAAGAAGC

Features of the protein sequence

Length: 438 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001084827 8.1e-174 98.1 serine (or cyst...
Macaca mulatta
P50454 5.9e-168 100.0 Serpin H1; Coll...
Homo sapiens
AAP36813 5.9e-168 100.0 serine (or cyst...
synthetic construct
AAH70087 1.1e-167 99.7 Serpin peptidas...
Homo sapiens
BAF82813 3.6e-167 99.7 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000215 56 429 PF00079 Protease inhibitor I4
HMMSmart IPR000215 72 429 SM00093 Protease inhibitor I4
ScanRegExp IPR000215 402 412 PS00284 Protease inhibitor I4
IPR000886 435 438 PS00014 Endoplasmic reticulum targeting sequence
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp