Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11585
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11585
Clone name bm01942
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol SDS
cDNA sequence DNA sequence (1583 bp)
Predicted protein sequence (347 aa)
Flexi ORF Clone FXC11585
Description serine dehydratase
Features of the cloned cDNA sequence

Length: 1583 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 493 bp
Genome contig ID gi89161190r_112214636
PolyA signal sequence
(AATAAA,-21)		 
+----*----+----*----+----*----+----
CTTTTTCATTGAAAAATAAAATATATTTATGAAAC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAAGATCCTGTGCATTTTCCCATCATCAGCTGTCTCCTTTCCTGCTTTCC

Features of the protein sequence

Length: 347 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW98055 1.7e-127 96.5 serine dehydrat...
 Homo sapiens
P20132 7.1e-127 100.0 L-serine dehydr...
 Homo sapiens
XP_509398 1.1e-125 99.0 serine dehydrat...
 Pan troglodytes
1P5J 1.7e-125 98.7

AAA36604 2.1e-124 98.4 serine dehydrat...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001926 23 317 PF00291 Pyridoxal phosphate-dependent enzyme
ScanRegExp IPR000634 51 64 PS00165 Serine/threonine dehydratase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp