ORK11592

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11592

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11592
Clone name	bm02579
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	IFIT1
cDNA sequence	DNA sequence (1765 bp) Predicted protein sequence (482 aa)
HaloTag ORF Clone	FHC11592
Flexi ORF Clone	FXC11592
Description	interferon-induced protein with tetratricopeptide repeats 1

Features of the cloned cDNA sequence

Description

Length: 1765 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	270 bp
Genome contig ID	gi89161187f_91042392
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AGTTAACTTTGTAGGAAATAAAACATTGGACTTAC
Flanking genome sequence (111329 - 111378)	----+--------+--------+--------+--------+----* ACTAAATGTTTAATTCATTCATTTTATTGTGAAATAAAAATAAAATCCTT

Features of the protein sequence

Description

Length: 482 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P09914	4e-196	100.0	Interferon-indu...	Homo sapiens
AAP36740	4e-196	100.0	interferon-indu...	synthetic construct
CAA27244	1.3e-195	99.7	unnamed protein...	Homo sapiens
XP_507904	1.6e-193	98.3	interferon-indu...	Pan troglodytes
XP_001142496	3.9e-193	98.1	interferon-indu...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001440	99	132	PF00515	Tetratricopeptide TPR_1
	IPR001440	145	178	PF00515	Tetratricopeptide TPR_1
	IPR013105	255	288	PF07719	Tetratricopeptide TPR_2
	IPR001440	344	377	PF00515	Tetratricopeptide TPR_1
	IPR001440	441	474	PF00515	Tetratricopeptide TPR_1
HMMSmart	IPR013026	56	89	SM00028	Tetratricopeptide region
	IPR013026	99	132	SM00028	Tetratricopeptide region
	IPR013026	145	178	SM00028	Tetratricopeptide region
	IPR013026	255	288	SM00028	Tetratricopeptide region
	IPR013026	344	377	SM00028	Tetratricopeptide region
	IPR013026	441	474	SM00028	Tetratricopeptide region
ProfileScan	IPR013026	56	89	PS50005	Tetratricopeptide region
	IPR013026	143	288	PS50293	Tetratricopeptide region
	IPR013026	145	178	PS50005	Tetratricopeptide region
	IPR013026	187	220	PS50005	Tetratricopeptide region
	IPR013026	255	288	PS50005	Tetratricopeptide region
	IPR013026	329	377	PS50293	Tetratricopeptide region
	IPR013026	344	377	PS50005	Tetratricopeptide region
	IPR013026	441	474	PS50005	Tetratricopeptide region
	IPR013026	441	474	PS50293	Tetratricopeptide region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp