ORK11598

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11598

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11598
Clone name	sj03569
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CLSTN3
cDNA sequence	DNA sequence (4248 bp) Predicted protein sequence (1038 aa)
HaloTag ORF Clone	FHC11598
Flexi ORF Clone	FXC11598
Description	calsyntenin 3

Features of the cloned cDNA sequence

Description

Length: 4248 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	855 bp
Genome contig ID	gi89161190f_7072953
PolyA signal sequence (AATAAA,-14)	+--------+--------+----*----+---- GGACATATCCTAGGGTTTTCAAATAAAACAATCAG
Flanking genome sequence (129844 - 129893)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGCTCTGTGAGGCGCCTCCTGACTGCCTGGTCCTGTGT

Features of the protein sequence

Description

Length: 1038 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9BQT9	100.0	Calsyntenin-3; ...	Homo sapiens
BAG61223	99.8	unnamed protein...	Homo sapiens
BAH14430	99.8	unnamed protein...	Homo sapiens
XP_001112325	99.0	calsyntenin 3 i...	Macaca mulatta
Q5R9Q9	99.0	Calsyntenin-3; ...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	186	198	PR00205	Cadherin
	IPR002126	206	225	PR00205	Cadherin
	IPR002126	225	238	PR00205	Cadherin
	IPR002126	278	304	PR00205	Cadherin
HMMPfam	IPR002126	115	218	PF00028	Cadherin
HMMPfam	IPR002126	232	321	PF00028	Cadherin
HMMSmart	IPR002126	132	225	SM00112	Cadherin
HMMSmart	IPR002126	248	326	SM00112	Cadherin
ProfileScan	IPR002126	111	227	PS50268	Cadherin
ProfileScan	IPR002126	228	328	PS50268	Cadherin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	929	AATLIIVVCVGFLVLMVVLGLVR	951	PRIMARY	23