ORK11608

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11608

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11608
Clone name	fh15286
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MBD6
cDNA sequence	DNA sequence (5399 bp) Predicted protein sequence (1006 aa)
HaloTag ORF Clone	FHC11608
Flexi ORF Clone	FXC11608
Description	methyl-CpG binding domain protein 6

Features of the cloned cDNA sequence

Description

Length: 5399 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	374 bp
Genome contig ID	gi89161190f_56101149
PolyA signal sequence (None)	+--------+--------+----*----+---- CTTAATTTAACAGATGAGAATATTTTGAAACTCTG
Flanking genome sequence (109051 - 109100)	----+--------+--------+--------+--------+----* GCTCTGGCTCTGTACTCATTTTTTATTTAGTTCTTTGGTAAGAACAGGTT

Features of the protein sequence

Description

Length: 1006 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96DN6	100.0	Methyl-CpG-bind...	Homo sapiens
AAH65530	99.9	Methyl-CpG bind...	Homo sapiens
BAB71176	99.9	unnamed protein...	Homo sapiens
XP_849726	95.2	similar to meth...	Canis lupus fam...
XP_001917827	94.6	similar to Meth...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001739	14	87	PF01429	Methyl-CpG binding
HMMSmart	IPR001739	17	91	SM00391	Methyl-CpG binding
ProfileScan	IPR001739	14	84	PS50982	Methyl-CpG binding

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp