ORK11610

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11610

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11610
Clone name	hj04936
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	KAT2B
cDNA sequence	DNA sequence (4764 bp) Predicted protein sequence (843 aa)
HaloTag ORF Clone	FHC11610
Flexi ORF Clone	FXC11610
Description	K(lysine) acetyltransferase 2B

Features of the cloned cDNA sequence

Description

Length: 4764 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1877 bp
Genome contig ID	gi89161205f_19956586
PolyA signal sequence (None)	+--------+--------+----*----+---- CAAAATAGTTTTAAATTATATTTTAAAAAGCTTCC
Flanking genome sequence (214314 - 214363)	----+--------+--------+--------+--------+----* AATCTTGTGGTGTGTTTTATTCATTCAGTAGGCTGAGGTTAACAGAACAA

Features of the protein sequence

Description

Length: 843 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92831	100.0	Histone acetylt...	Homo sapiens
AAC50890	99.7	p300/CBP-associ...	Homo sapiens
XP_516321	99.8	p300/CBP-associ...	Pan troglodytes
EAW64305	94.1	p300/CBP-associ...	Homo sapiens
Q9JHD1	92.9	Histone acetylt...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001487	754	767	PR00503	Bromodomain
	IPR001487	768	784	PR00503	Bromodomain
	IPR001487	784	802	PR00503	Bromodomain
	IPR001487	802	821	PR00503	Bromodomain
HMMPfam	IPR009464	86	338	PF06466	PCAF
	IPR000182	557	634	PF00583	GCN5-related N-acetyltransferase
	IPR001487	739	826	PF00439	Bromodomain
HMMSmart	IPR001487	732	840	SM00297	Bromodomain
ProfileScan	IPR000182	514	662	PS51186	GCN5-related N-acetyltransferase
ProfileScan	IPR001487	751	821	PS50014	Bromodomain
ScanRegExp	IPR001487	756	813	PS00633	Bromodomain

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp