Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11611
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11611
Clone name ee21340
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol HIVEP1
cDNA sequence DNA sequence (9043 bp)
Predicted protein sequence (2728 aa)
Flexi ORF Clone FXC11611
Description human immunodeficiency virus type I enhancer binding protein 1
Features of the cloned cDNA sequence

Length: 9043 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 537 bp
Genome contig ID gi89161210f_12020540
PolyA signal sequence
(AGTAAA,-24)		 
+----*----+----*----+----*----+----
TGAAATGTTTCAGTAAAATATTGTTTACTGACTTT
Flanking genome sequence
(252679 - 252728)		 
----+----*----+----*----+----*----+----*----+----*
ACCATTGCTTCAGTTGTGCCTTCTTTATATCATCCAGTGATCAGTGATCT

Features of the protein sequence

Length: 2728 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW55311 0 100.0 human immunodef...
 Homo sapiens
EAW55310 0 99.9 human immunodef...
 Homo sapiens
NP_002105 0 99.8 zinc finger pro...
 Homo sapiens
AAI40817 0 99.8 immunodeficienc...
 Homo sapiens
P15822 0 99.7 Zinc finger pro...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007087 416 438 PF00096 Zinc finger
IPR007087 444 466 PF00096 Zinc finger
IPR007087 2098 2120 PF00096 Zinc finger
IPR007087 2126 2150 PF00096 Zinc finger
HMMSmart IPR015880 416 438 SM00355 Zinc finger
IPR015880 444 466 SM00355 Zinc finger
IPR015880 969 996 SM00355 Zinc finger
IPR015880 2098 2120 SM00355 Zinc finger
IPR015880 2126 2150 SM00355 Zinc finger
ProfileScan IPR007087 416 443 PS50157 Zinc finger
IPR007087 444 467 PS50157 Zinc finger
IPR007087 2098 2125 PS50157 Zinc finger
IPR007087 2126 2151 PS50157 Zinc finger
ScanRegExp IPR007087 418 438 PS00028 Zinc finger
IPR007087 446 468 PS00028 Zinc finger
IPR007087 2100 2120 PS00028 Zinc finger
IPR007087 2128 2150 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp