ORK11612

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11612

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11612
Clone name	hg01171
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	COL4A3BP
cDNA sequence	DNA sequence (2379 bp) Predicted protein sequence (753 aa)
HaloTag ORF Clone	FHC11612
Flexi ORF Clone	FXC11612
Description	collagen, type IV, alpha 3 (Goodpasture antigen) binding protein

Features of the cloned cDNA sequence

Description

Length: 2379 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	46 bp
Genome contig ID	gi51511721r_74605736
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTGAAGCAAGGCTGTGTGACATTCCATGTTGGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAGAAAAAAAAAAGCTGAATGCTCTAAGCTGGAACGTAGGATCTA

Features of the protein sequence

Description

Length: 753 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW95760	98.5	collagen, type ...	Homo sapiens
XP_001504726	90.2	similar to Coll...	Equus caballus
Q9Y5P4	100.0	Collagen type I...	Homo sapiens
XP_849925	98.3	similar to Good...	Canis lupus fam...
Q5R6M6	99.0	Collagen type I...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	153	246	PF00169	Pleckstrin-like
HMMPfam	IPR002913	527	748	PF01852	Lipid-binding START
HMMSmart	IPR001849	153	248	SM00233	Pleckstrin-like
HMMSmart	IPR002913	527	748	SM00234	Lipid-binding START
ProfileScan	IPR001849	152	246	PS50003	Pleckstrin-like
ProfileScan	IPR002913	544	747	PS50848	Lipid-binding START

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp