ORK11613

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11613

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11613
Clone name	fj12189
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PCDH20
cDNA sequence	DNA sequence (4192 bp) Predicted protein sequence (934 aa)
HaloTag ORF Clone	FHC11613
Flexi ORF Clone	FXC11613
Description	protocadherin 20

Features of the cloned cDNA sequence

Description

Length: 4192 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1385 bp
Genome contig ID	gi51511729r_60781994
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TTATATGTCTGCAAATTAAAGGTATATATTTTCAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTTCTTTCTCACTTTTAGCATTTTATATTTGAACATGGGCTTGTTATT

Features of the protein sequence

Description

Length: 934 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAD38690	100.0	hypothetical pr...	Homo sapiens
AAF89690	99.8	protocadherin 1...	Homo sapiens
Q8N6Y1	100.0	Protocadherin-2...	Homo sapiens
BAG37177	99.7	unnamed protein...	Homo sapiens
XP_001086611	98.1	protocadherin 2...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	352	371	PR00205	Cadherin
	IPR002126	518	547	PR00205	Cadherin
	IPR002126	587	599	PR00205	Cadherin
	IPR002126	601	620	PR00205	Cadherin
	IPR002126	620	633	PR00205	Cadherin
	IPR002126	673	699	PR00205	Cadherin
	IPR002126	707	724	PR00205	Cadherin
HMMPfam	IPR013164	49	169	PF08266	Cadherin
	IPR002126	197	294	PF00028	Cadherin
	IPR002126	308	365	PF00028	Cadherin
	IPR002126	523	613	PF00028	Cadherin
	IPR002126	627	716	PF00028	Cadherin
	IPR002126	734	827	PF00028	Cadherin
HMMSmart	IPR002126	215	301	SM00112	Cadherin
	IPR002126	325	407	SM00112	Cadherin
	IPR002126	437	516	SM00112	Cadherin
	IPR002126	540	620	SM00112	Cadherin
	IPR002126	644	723	SM00112	Cadherin
	IPR002126	750	834	SM00112	Cadherin
ProfileScan	IPR002126	47	192	PS50268	Cadherin
	IPR002126	193	303	PS50268	Cadherin
	IPR002126	304	518	PS50268	Cadherin
	IPR002126	519	622	PS50268	Cadherin
	IPR002126	623	725	PS50268	Cadherin
	IPR002126	729	846	PS50268	Cadherin
ScanRegExp	IPR002126	180	190	PS00232	Cadherin
	IPR002126	291	301	PS00232	Cadherin
	IPR002126	506	516	PS00232	Cadherin
	IPR002126	610	620	PS00232	Cadherin
	IPR002126	713	723	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	24	RNLPHLFLFFLFVGPFSCLGSYS	46	SECONDARY	23
SOSUI2	2	871	PTLVALSVISLGSITLVTGMGIY	893	PRIMARY	23