ORK11614

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11614

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11614
Clone name	pj00226
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PDE1C
cDNA sequence	DNA sequence (4576 bp) Predicted protein sequence (761 aa)
HaloTag ORF Clone	FHC11614
Flexi ORF Clone	FXC11614
Description	phosphodiesterase 1C, calmodulin-dependent 70kDa

Features of the cloned cDNA sequence

Description

Length: 4576 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2201 bp
Genome contig ID	gi89161213r_31657321
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TATATTCTTACAGCAAATAAAAAGATGCTTTTAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGACTTTCTTGTATGTGAGCCATTTTCTTCTCTGAAATTCCGGGATGTTA

Features of the protein sequence

Description

Length: 761 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14123	100.0	Calcium/calmodu...	Homo sapiens
BAG52838	99.8	unnamed protein...	Homo sapiens
XP_001083512	97.1	phosphodiestera...	Macaca mulatta
XP_001500820	95.9	similar to Calc...	Equus caballus
EDL88062	95.0	phosphodiestera...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002073	275	288	PR00387	3'5'-cyclic nucleotide phosphodiesterase
	IPR002073	306	319	PR00387	3'5'-cyclic nucleotide phosphodiesterase
	IPR002073	320	335	PR00387	3'5'-cyclic nucleotide phosphodiesterase
	IPR002073	347	363	PR00387	3'5'-cyclic nucleotide phosphodiesterase
	IPR002073	424	437	PR00387	3'5'-cyclic nucleotide phosphodiesterase
	IPR002073	441	457	PR00387	3'5'-cyclic nucleotide phosphodiesterase
HMMPfam	IPR013706	134	194	PF08499	3'5'-cyclic nucleotide phosphodiesterase N-terminal
HMMPfam	IPR002073	279	511	PF00233	3'5'-cyclic nucleotide phosphodiesterase
HMMSmart	IPR003607	277	442	SM00471	Metal-dependent phosphohydrolase
ScanRegExp	IPR002073	320	331	PS00126	3'5'-cyclic nucleotide phosphodiesterase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp