ORK11621

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11621

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11621
Clone name	hk08207
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PC
cDNA sequence	DNA sequence (3991 bp) Predicted protein sequence (1204 aa)
HaloTag ORF Clone	FHC11621
Flexi ORF Clone	FXC11621
Description	keratin 17

Features of the cloned cDNA sequence

Description

Length: 3991 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	374 bp
Genome contig ID	gi51511727r_66272572
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GGAAGTTTACTCAATAAAGCTGGCTTTCCCCTGCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTCCATGCTGGATCCTGTGCAGCCCCCAGCCTGCACCACTCAGCAGTGGG

Features of the protein sequence

Description

Length: 1204 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P11498	100.0	Pyruvate carbox...	Homo sapiens
AAA82937	99.9	pyruvate carbox...	Homo sapiens
XP_001107749	99.2	pyruvate carbox...	Macaca mulatta
AAB31500	99.1	pyruvate carbox...	Homo sapiens
AAP57516	97.9	pyruvate carbox...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005481	62	175	PF00289	Carbamoyl-phosphate synthetase large chain
	IPR005479	177	394	PF02786	Carbamoyl-phosphate synthase L chain
	IPR005482	401	508	PF02785	Biotin carboxylase
	IPR000891	597	823	PF00682	Pyruvate carboxyltransferase
	IPR003379	887	1095	PF02436	Conserved carboxylase region
	IPR000089	1136	1203	PF00364	Biotin/lipoyl attachment
HMMTigr	IPR005930	65	1204	TIGR01235	Pyruvate carboxylase
ProfileScan	IPR011764	62	512	PS50979	Biotin carboxylation region
	IPR011761	182	379	PS50975	ATP-grasp fold
	IPR000891	589	858	PS50991	Pyruvate carboxyltransferase
	IPR000089	1136	1203	PS50968	Biotin/lipoyl attachment
ScanRegExp	IPR001882	1160	1177	PS00188	Biotin-binding site

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp