ORK11635

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11635

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11635
Clone name	eh00724
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	RGS12
cDNA sequence	DNA sequence (5490 bp) Predicted protein sequence (1400 aa)
HaloTag ORF Clone	FHC11635
Flexi ORF Clone	FXC11635
Description	regulator of G-protein signaling 12

Features of the cloned cDNA sequence

Description

Length: 5490 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1199 bp
Genome contig ID	gi89161207f_3187598
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TGTTCTTCCAGGAGTAATAAATTCTGGACATCATC
Flanking genome sequence (216100 - 216149)	----+--------+--------+--------+--------+----* ACTGGACTGGCTTACAACTTTTCTTTCTCATTTGAAACTTTGTTTCCACT

Features of the protein sequence

Description

Length: 1400 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAC39835	100.0	RGS12 [Homo sap...	Homo sapiens
O14924	99.9	Regulator of G-...	Homo sapiens
EAW82467	99.2	regulator of G-...	Homo sapiens
EDL37473	85.2	regulator of G-...	Mus musculus
AAH40396	85.2	Regulator of G-...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000342	760	859	PD001580	Regulator of G protein signalling
FPrintScan	IPR000342	736	757	PR01301	Regulator of G protein signalling
	IPR000342	758	776	PR01301	Regulator of G protein signalling
	IPR000342	789	812	PR01301	Regulator of G protein signalling
	IPR000342	830	849	PR01301	Regulator of G protein signalling
HMMPfam	IPR001478	46	120	PF00595	PDZ/DHR/GLGF
	IPR000342	739	856	PF00615	Regulator of G protein signalling
	IPR003116	986	1056	PF02196	Raf-like Ras-binding
	IPR003116	1058	1128	PF02196	Raf-like Ras-binding
	IPR003109	1211	1233	PF02188	GoLoco
HMMSmart	IPR001478	54	123	SM00228	PDZ/DHR/GLGF
	IPR006020	249	398	SM00462	Phosphotyrosine interaction region
	IPR000342	739	856	SM00315	Regulator of G protein signalling
	IPR003116	986	1056	SM00455	Raf-like Ras-binding
	IPR003116	1058	1128	SM00455	Raf-like Ras-binding
	IPR003109	1211	1233	SM00390	GoLoco
ProfileScan	IPR001478	46	123	PS50106	PDZ/DHR/GLGF
	IPR006020	252	364	PS01179	Phosphotyrosine interaction region
	IPR000342	739	856	PS50132	Regulator of G protein signalling
	IPR003116	986	1056	PS50898	Raf-like Ras-binding
	IPR003116	1058	1128	PS50898	Raf-like Ras-binding
	IPR003109	1211	1233	PS50877	GoLoco

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp