Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11642
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11642
Clone name ef06191
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol AFAP1
cDNA sequence DNA sequence (7413 bp)
Predicted protein sequence (731 aa)
Flexi ORF Clone FXC11642
Description actin filament associated protein 1
Features of the cloned cDNA sequence

Length: 7413 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 5051 bp
Genome contig ID gi89161207r_7711342
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
GTGCCCCTTTGTGTATGAATAAACTTCTCTCCCCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGCCCCGGTGTCTTCACTGCCCTTGGTGTGTGCTGCACACTGAGAAGTGG

Features of the protein sequence

Length: 731 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8N556 0 99.8 Actin filament-...
Homo sapiens
BAF83496 0 99.7 unnamed protein...
Homo sapiens
AAH32777 0 99.7 Actin filament ...
Homo sapiens
XP_517101 0 99.5 actin filament ...
Pan troglodytes
AAG17055 0 99.4 actin filament ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001849 155 250 PF00169 Pleckstrin-like
IPR001849 349 442 PF00169 Pleckstrin-like
HMMSmart IPR001849 155 252 SM00233 Pleckstrin-like
IPR001849 349 444 SM00233 Pleckstrin-like
ProfileScan IPR001849 154 250 PS50003 Pleckstrin-like
IPR001849 348 442 PS50003 Pleckstrin-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp