Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11644
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11644
Clone name fj16913
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol TBC1D10B
cDNA sequence DNA sequence (3316 bp)
Predicted protein sequence (851 aa)
Flexi ORF Clone FXC11644
Description TBC1 domain family, member 10B
Features of the cloned cDNA sequence

Length: 3316 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 758 bp
Genome contig ID gi51511732r_30176008
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GTAAGGGTCTTCCCTTGAGCTCCAGGGGGTGGAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CCAATGTTTACATTCTCTTCTGTCTCTGCCCCCACCCCATGCAGCGCTTT

Features of the protein sequence

Length: 851 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
NP_056342 2.6e-195 99.8 TBC1 domain fam...
Homo sapiens
XP_510925 1.1e-193 99.0 TBC1 domain fam...
Pan troglodytes
XP_591615 1.2e-176 87.3 similar to TBC1...
Bos taurus
AAH98419 1.5e-160 99.8 TBC1D10B protei...
Homo sapiens
XP_001501570 3.7e-159 89.7 TBC1 domain fam...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000195 400 616 PF00566 RabGAP/TBC
HMMSmart IPR000195 400 614 SM00164 RabGAP/TBC
ProfileScan IPR000195 403 591 PS50086 RabGAP/TBC
ScanRegExp IPR000581 515 525 PS00886 Dihydroxy-acid and 6-phosphogluconate dehydratase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp