Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11646
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11646
Clone name sj03926
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol GIGYF1
cDNA sequence DNA sequence (4341 bp)
Predicted protein sequence (1053 aa)
Flexi ORF Clone FXC11646
Description GRB10 interacting GYF protein 1
Features of the cloned cDNA sequence

Length: 4341 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 375 bp
Genome contig ID gi89161213r_100016947
PolyA signal sequence
(AAGAAA,-14)
+----*----+----*----+----*----+----
TTGGTTTTTTTTTTTTTTTTTAAGAAAAAAAGATG
Flanking genome sequence
(99956 - 99907)
----+----*----+----*----+----*----+----*----+----*
AAAAATGAAAAAAAAAATGGTTAGGAGGCTGAAAGAAAAAACACACTGTT

Features of the protein sequence

Length: 1053 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O75420 0 100.0 PERQ amino acid...
Homo sapiens
XP_001104969 0 97.9 similar to PERQ...
Macaca mulatta
XP_001505114 0 93.7 GRB10 interacti...
Equus caballus
XP_546951 0 94.0 similar to PERQ...
Canis lupus fam...
XP_610923 0 93.1 similar to PERQ...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003169 493 548 PF02213 GYF
HMMSmart IPR003169 493 548 SM00444 GYF
ProfileScan IPR003169 492 540 PS50829 GYF
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp