ORK11647

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11647

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11647
Clone name	ej00503
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	SIN3A
cDNA sequence	DNA sequence (4952 bp) Predicted protein sequence (1281 aa)
HaloTag ORF Clone	FHC11647
Flexi ORF Clone	FXC11647
Description	SIN3 homolog A, transcription regulator (yeast)

Features of the cloned cDNA sequence

Description

Length: 4952 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	835 bp
Genome contig ID	gi51511731r_73350538
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TACTGTCAATTTTTTATTAAAAGAAATATGCTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGTGCTAGCATAACTGCTCTAGCTTCTTGTGTACCATAGTACTGTGGCT

Features of the protein sequence

Description

Length: 1281 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96ST3	99.9	Paired amphipat...	Homo sapiens
XP_510682	99.8	transcriptional...	Pan troglodytes
AAP97288	99.7	MSIN3A [Homo sa...	Homo sapiens
XP_001103539	99.7	similar to tran...	Macaca mulatta
XP_001491398	98.8	SIN3 homolog A,...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003822	149	195	PF02671	Paired amphipathic helix
	IPR003822	330	389	PF02671	Paired amphipathic helix
	IPR003822	485	531	PF02671	Paired amphipathic helix
	IPR013194	558	658	PF08295	Histone deacetylase interacting
HMMSmart	IPR013194	558	658	SM00761	Histone deacetylase interacting

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp