ORK11739

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11739

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11739
Clone name	ee04183
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	PRDM8
cDNA sequence	DNA sequence (3228 bp) Predicted protein sequence (746 aa)
HaloTag ORF Clone	FHC11739
Flexi ORF Clone	FXC11739
Description	PR domain containing 8

Features of the cloned cDNA sequence

Description

Length: 3228 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	794 bp
Genome contig ID	gi89161207f_81237172
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- ATGCTTTGACAATAAATGACTATTTTCTTCAAAGC
Flanking genome sequence (107334 - 107383)	----+--------+--------+--------+--------+----* AAATATTTGGAAAGTTTTTAAATTTTATCGTTGTAGTTAAGGACTATACT

Features of the protein sequence

Description

Length: 746 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9NQV8	2.1e-216	100.0	PR domain zinc ...	Homo sapiens
AAH71584	5e-216	99.7	PRDM8 protein [...	Homo sapiens
XP_001090342	4.7e-212	97.8	PR domain conta...	Macaca mulatta
AAI41021	3.9e-186	87.4	PR domain conta...	Mus musculus
Q8BZ97	5.9e-176	87.0	PR domain zinc ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	723	745	PF00096	Zinc finger
HMMSmart	IPR015880	212	240	SM00355	Zinc finger
	IPR015880	682	704	SM00355	Zinc finger
	IPR015880	723	745	SM00355	Zinc finger
ProfileScan	IPR007087	682	710	PS50157	Zinc finger
ProfileScan	IPR007087	723	746	PS50157	Zinc finger
ScanRegExp	IPR000217	532	538	PS00227	Tubulin
	IPR007087	684	705	PS00028	Zinc finger
	IPR007087	725	745	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp