ORK11779

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11779

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11779
Clone name	af07308
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No.X52328, AmpR). The cDNA includes the following sequence (5'GTCGACCCAC GCGTCCGCCC ACGCGTCCGC GGACGCGTGG GTCGCCCACG CGTCCGCCCA CGCGTCCG3') at the 5' portion and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone af07308 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCGC GGACGCGTGG GTCGCCCACG CGTCCGCCCA CGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	CHD3
cDNA sequence	DNA sequence (7323 bp) Predicted protein sequence (2005 aa)
HaloTag ORF Clone	FHC11779
Flexi ORF Clone	FXC11779
Description	Chromodomain-helicase-DNA-binding protein 3

Features of the cloned cDNA sequence

Description

Length: 7323 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1170 bp
Genome contig ID	gi51511734f_7632882
PolyA signal sequence (TATAAA,-21)	+--------+--------+----*----+---- TTATTGGTTGTACATATAAATTATACTTTCCTTTC
Flanking genome sequence (123918 - 123967)	----+--------+--------+--------+--------+----* TGTGTGCTCTGTTATTTTTTATGGGGGGGGGGAGTTTTTGGGGGGAGGGA

Features of the protein sequence

Description

Length: 2005 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q12873	99.8	Chromodomain-he...	Homo sapiens
AAC39923	99.7	zinc-finger hel...	Homo sapiens
AAI56473	99.7	Chromodomain he...	synthetic construct
NP_001005271	99.7	chromodomain-he...	Homo sapiens
XP_536627	98.1	similar to chro...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012958	156	210	PF08073	CHD
	IPR001965	386	431	PF00628	Zinc finger
	IPR001965	463	508	PF00628	Zinc finger
	IPR000953	636	688	PF00385	Chromo
	IPR000330	744	1040	PF00176	SNF2-related
	IPR001650	1100	1179	PF00271	DNA/RNA helicase
	IPR009463	1298	1362	PF06465	Protein of unknown function DUF1087
	IPR009462	1368	1524	PF06461	Protein of unknown function DUF1086
	IPR012957	1739	1912	PF08074	CHD
HMMSmart	IPR001965	386	429	SM00249	Zinc finger
	IPR001965	463	506	SM00249	Zinc finger
	IPR000953	511	590	SM00298	Chromo
	IPR000953	634	683	SM00298	Chromo
	IPR014001	737	949	SM00487	DEAD-like helicases
	IPR001650	1095	1179	SM00490	DNA/RNA helicase
ProfileScan	IPR001965	384	431	PS50016	Zinc finger
	IPR001965	461	508	PS50016	Zinc finger
	IPR000953	541	598	PS50013	Chromo
	IPR000953	636	672	PS50013	Chromo
	IPR014021	753	937	PS51192	Helicase
	IPR001650	1069	1234	PS51194	DNA/RNA helicase
ScanRegExp	IPR001965	387	428	PS01359	Zinc finger
	IPR001965	464	505	PS01359	Zinc finger
	IPR000953	654	673	PS00598	Chromo
	IPR002464	883	892	PS00690	DNA/RNA helicase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp