Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11793
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11793
Clone name bn02138
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CALM2
cDNA sequence DNA sequence (1079 bp)
Predicted protein sequence (156 aa)
Flexi ORF Clone FXC11793
Description Calmodulin (CaM)
Features of the cloned cDNA sequence

Length: 1079 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 606 bp
Genome contig ID gi89161199r_47140829
PolyA signal sequence
(AATAAA,-19)		 
+----*----+----*----+----*----+----
TGTATATTTGTTTTCCAATAAAAAAATTACAATTT
Flanking genome sequence
(99984 - 99935)		 
----+----*----+----*----+----*----+----*----+----*
ACCCAATGGTTGCTCTGCATCTGAGTCATTTAACTGTTGAAGTCTAATAA

Features of the protein sequence

Length: 156 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
2WEL 4.6e-53 100.0 CALCIUM/CALMODU...
 Homo sapiens
P62161 9.4e-53 100.0 Calmodulin; Sho...
 Rattus norvegicus
AAX37095 9.5e-53 100.0 calmodulin 2 [s...
 synthetic construct
AAP36156 9.5e-53 100.0 calmodulin 1 (p...
 synthetic construct
2F2O 1.1e-52 100.0 Calmodulin fuse...
 Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR002048 13 52 PD000012 Calcium-binding EF-hand
IPR002048 59 144 PD000012 Calcium-binding EF-hand
FPrintScan IPR001125 12 31 PR00450 Recoverin
IPR001125 59 80 PR00450 Recoverin
IPR001125 106 124 PR00450 Recoverin
HMMPfam IPR002048 19 47 PF00036 Calcium-binding EF-hand
IPR002048 55 83 PF00036 Calcium-binding EF-hand
IPR002048 92 120 PF00036 Calcium-binding EF-hand
IPR002048 128 156 PF00036 Calcium-binding EF-hand
HMMSmart IPR002048 19 47 SM00054 Calcium-binding EF-hand
IPR002048 55 83 SM00054 Calcium-binding EF-hand
IPR002048 92 120 SM00054 Calcium-binding EF-hand
IPR002048 128 156 SM00054 Calcium-binding EF-hand
ProfileScan IPR002048 15 50 PS50222 Calcium-binding EF-hand
IPR002048 51 86 PS50222 Calcium-binding EF-hand
IPR002048 88 123 PS50222 Calcium-binding EF-hand
IPR002048 124 156 PS50222 Calcium-binding EF-hand
ScanRegExp IPR002048 28 40 PS00018 Calcium-binding EF-hand
IPR002048 64 76 PS00018 Calcium-binding EF-hand
IPR002048 101 113 PS00018 Calcium-binding EF-hand
IPR002048 137 149 PS00018 Calcium-binding EF-hand
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp