Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11798
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11798
Clone name ee15524
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ZNF263
cDNA sequence DNA sequence (3259 bp)
Predicted protein sequence (698 aa)
Flexi ORF Clone FXC11798
Description Zinc finger protein 263 (Zinc finger protein FPM315)(Zinc finger protein with KRAB and SCAN domains 12)
Features of the cloned cDNA sequence

Length: 3259 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 900 bp
Genome contig ID gi51511732f_3173511
PolyA signal sequence
(AATAAA,-22)		 
+----*----+----*----+----*----+----
ATGTTTGGATGGGAATAAATATCTTCAGGAAACAT
Flanking genome sequence
(107949 - 107998)		 
----+----*----+----*----+----*----+----*----+----*
AAATGTCTGTGAGTCTTCAATGAAAGCCTCTGTCTAGACCCCCGAGTGTT

Features of the protein sequence

Length: 698 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O14978 0 100.0 Zinc finger pro...
 Homo sapiens
AAP36185 0 100.0 zinc finger pro...
 synthetic construct
EAW85378 0 100.0 zinc finger pro...
 Homo sapiens
BAA21853 0 99.8 zinc finger pro...
 Homo sapiens
XP_001166381 0 99.2 zinc finger pro...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 395 415 PD000003 Zinc finger
IPR007087 449 472 PD000003 Zinc finger
IPR007087 477 500 PD000003 Zinc finger
IPR007087 505 528 PD000003 Zinc finger
IPR007087 533 555 PD000003 Zinc finger
IPR007087 590 613 PD000003 Zinc finger
IPR007087 618 641 PD000003 Zinc finger
IPR007087 646 669 PD000003 Zinc finger
IPR007087 674 697 PD000003 Zinc finger
HMMPfam IPR003309 50 145 PF02023 Transcriptional regulator SCAN
IPR001909 233 272 PF01352 KRAB box
IPR007087 393 415 PF00096 Zinc finger
IPR007087 449 471 PF00096 Zinc finger
IPR007087 477 499 PF00096 Zinc finger
IPR007087 505 527 PF00096 Zinc finger
IPR007087 533 555 PF00096 Zinc finger
IPR007087 590 612 PF00096 Zinc finger
IPR007087 618 640 PF00096 Zinc finger
IPR007087 646 668 PF00096 Zinc finger
IPR007087 674 696 PF00096 Zinc finger
HMMSmart IPR003309 52 164 SM00431 Transcriptional regulator SCAN
IPR001909 232 293 SM00349 KRAB box
IPR015880 393 415 SM00355 Zinc finger
IPR015880 449 471 SM00355 Zinc finger
IPR015880 477 499 SM00355 Zinc finger
IPR015880 505 527 SM00355 Zinc finger
IPR015880 533 555 SM00355 Zinc finger
IPR015880 590 612 SM00355 Zinc finger
IPR015880 618 640 SM00355 Zinc finger
IPR015880 646 668 SM00355 Zinc finger
IPR015880 674 696 SM00355 Zinc finger
ProfileScan IPR003309 56 138 PS50804 Transcriptional regulator SCAN
IPR001909 232 304 PS50805 KRAB box
IPR007087 393 420 PS50157 Zinc finger
IPR007087 449 476 PS50157 Zinc finger
IPR007087 477 504 PS50157 Zinc finger
IPR007087 505 532 PS50157 Zinc finger
IPR007087 533 560 PS50157 Zinc finger
IPR007087 590 617 PS50157 Zinc finger
IPR007087 618 645 PS50157 Zinc finger
IPR007087 646 673 PS50157 Zinc finger
IPR007087 674 698 PS50157 Zinc finger
ScanRegExp IPR007087 395 415 PS00028 Zinc finger
IPR007087 451 471 PS00028 Zinc finger
IPR007087 479 499 PS00028 Zinc finger
IPR007087 507 527 PS00028 Zinc finger
IPR007087 535 555 PS00028 Zinc finger
IPR007087 592 612 PS00028 Zinc finger
IPR007087 620 640 PS00028 Zinc finger
IPR007087 648 668 PS00028 Zinc finger
IPR007087 676 696 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp