ORK11800

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11800

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11800
Clone name	ee24251
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	GATA6
cDNA sequence	DNA sequence (3218 bp) Predicted protein sequence (605 aa)
Description	Transcription factor GATA-6 (GATA-binding factor 6)

Features of the cloned cDNA sequence

Description

Length: 3218 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1157 bp
Genome contig ID	gi51511735f_17903406
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TTTAAAAATAAAAAGGGTATTGTTTTGTCTTCTGT
Flanking genome sequence (132538 - 132587)	----+--------+--------+--------+--------+----* ACAGTGAGTTCCTTCCCTTTTCAAAGCTTTCTTTTTATGCTGTATGTGAC

Features of the protein sequence

Description

Length: 605 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q92908	1.8e-175	100.0	Transcription f...	Homo sapiens
BAD97267	2.6e-175	99.8	GATA binding pr...	Homo sapiens
P46153	1.6e-155	90.4	Transcription f...	Rattus norvegicus
Q61169	4.6e-154	89.2	Transcription f...	Mus musculus
XP_001363044	2.8e-134	79.1	similar to GATA...	Monodelphis dom...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000679	396	413	PR00619	Zinc finger
FPrintScan	IPR000679	414	431	PR00619	Zinc finger
HMMPfam	IPR008013	157	391	PF05349	GATA-type transcription activator
	IPR000679	400	434	PF00320	Zinc finger
	IPR000679	454	488	PF00320	Zinc finger
HMMSmart	IPR000679	394	445	SM00401	Zinc finger
HMMSmart	IPR000679	448	498	SM00401	Zinc finger
ProfileScan	IPR000679	394	448	PS50114	Zinc finger
ProfileScan	IPR000679	448	501	PS50114	Zinc finger
ScanRegExp	IPR000679	400	424	PS00344	Zinc finger
ScanRegExp	IPR000679	454	478	PS00344	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp