Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11803
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11803
Clone name ej01005
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PAPOLA
cDNA sequence DNA sequence (4482 bp)
Predicted protein sequence (779 aa)
Description Poly(A) polymerase alpha (PAP-alpha)(EC 2.7.7.19)(Polynucleotide adenylyltransferase alpha)
Features of the cloned cDNA sequence

Length: 4482 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2065 bp
Genome contig ID gi51511730f_95938504
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TTGAAAACACAATAAAAAAAAAACAGCACAATCTC
Flanking genome sequence
(164703 - 164752)
----+----*----+----*----+----*----+----*----+----*
ACAGTTGCCTGATTTCTTTTGACTACTACTTTTTTCCAGTAATCATAAGT

Features of the protein sequence

Length: 779 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG63716 0 99.7 unnamed protein...
Homo sapiens
P51003 0 100.0 Poly(A) polymer...
Homo sapiens
EAW81649 0 99.8 poly(A) polymer...
Homo sapiens
XP_001929110 0 98.1 similar to poly...
Sus scrofa
XP_001489128 0 98.1 similar to poly...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007012 51 399 PF04928 Poly(A) polymerase
IPR002934 116 209 PF01909 DNA polymerase
IPR007010 400 542 PF04926 Poly(A) polymerase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp