ORK11805

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11805

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11805
Clone name	ff05119
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ZNF599
cDNA sequence	DNA sequence (4109 bp) Predicted protein sequence (679 aa)
HaloTag ORF Clone	FHC11805
Flexi ORF Clone	FXC11805
Description	Zinc finger protein 599

Features of the cloned cDNA sequence

Description

Length: 4109 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	960 bp
Genome contig ID	gi42406306r_39840819
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ATTATTCTTTATAATAAAAATATTTTAATTATAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGTTTGTGTAATGTACTCAGTATATTATTGTACTGCTTTAACTCTTAAT

Features of the protein sequence

Description

Length: 679 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96NL3	0	100.0	Zinc finger pro...	Homo sapiens
XP_001092559	0	95.9	similar to zinc...	Macaca mulatta
AAH44615	0	99.8	ZNF599 protein ...	Homo sapiens
XP_001092445	0	95.8	similar to zinc...	Macaca mulatta
XP_001490210	4.2e-214	88.2	zinc finger pro...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	290	312	PD000003	Zinc finger
	IPR007087	318	341	PD000003	Zinc finger
	IPR007087	346	369	PD000003	Zinc finger
	IPR007087	374	397	PD000003	Zinc finger
	IPR007087	404	425	PD000003	Zinc finger
	IPR007087	430	453	PD000003	Zinc finger
	IPR007087	460	481	PD000003	Zinc finger
	IPR007087	486	509	PD000003	Zinc finger
	IPR007087	514	537	PD000003	Zinc finger
	IPR007087	542	565	PD000003	Zinc finger
	IPR007087	571	593	PD000003	Zinc finger
	IPR007087	598	621	PD000003	Zinc finger
	IPR007087	626	649	PD000003	Zinc finger
HMMPfam	IPR001909	100	140	PF01352	KRAB box
	IPR007087	290	312	PF00096	Zinc finger
	IPR007087	318	340	PF00096	Zinc finger
	IPR007087	346	368	PF00096	Zinc finger
	IPR007087	374	396	PF00096	Zinc finger
	IPR007087	402	424	PF00096	Zinc finger
	IPR007087	430	452	PF00096	Zinc finger
	IPR007087	458	480	PF00096	Zinc finger
	IPR007087	486	508	PF00096	Zinc finger
	IPR007087	514	536	PF00096	Zinc finger
	IPR007087	542	564	PF00096	Zinc finger
	IPR007087	570	592	PF00096	Zinc finger
	IPR007087	598	620	PF00096	Zinc finger
	IPR007087	626	648	PF00096	Zinc finger
	IPR007087	654	676	PF00096	Zinc finger
HMMSmart	IPR001909	100	160	SM00349	KRAB box
	IPR015880	290	312	SM00355	Zinc finger
	IPR015880	318	340	SM00355	Zinc finger
	IPR015880	346	368	SM00355	Zinc finger
	IPR015880	374	396	SM00355	Zinc finger
	IPR015880	402	424	SM00355	Zinc finger
	IPR015880	430	452	SM00355	Zinc finger
	IPR015880	458	480	SM00355	Zinc finger
	IPR015880	486	508	SM00355	Zinc finger
	IPR015880	514	536	SM00355	Zinc finger
	IPR015880	542	564	SM00355	Zinc finger
	IPR015880	570	592	SM00355	Zinc finger
	IPR015880	598	620	SM00355	Zinc finger
	IPR015880	626	648	SM00355	Zinc finger
	IPR015880	654	676	SM00355	Zinc finger
ProfileScan	IPR001909	100	171	PS50805	KRAB box
	IPR007087	290	317	PS50157	Zinc finger
	IPR007087	318	345	PS50157	Zinc finger
	IPR007087	346	373	PS50157	Zinc finger
	IPR007087	374	401	PS50157	Zinc finger
	IPR007087	402	429	PS50157	Zinc finger
	IPR007087	430	457	PS50157	Zinc finger
	IPR007087	458	485	PS50157	Zinc finger
	IPR007087	486	513	PS50157	Zinc finger
	IPR007087	514	541	PS50157	Zinc finger
	IPR007087	542	569	PS50157	Zinc finger
	IPR007087	570	597	PS50157	Zinc finger
	IPR007087	598	625	PS50157	Zinc finger
	IPR007087	626	653	PS50157	Zinc finger
	IPR007087	654	679	PS50157	Zinc finger
ScanRegExp	IPR007087	292	312	PS00028	Zinc finger
	IPR007087	320	340	PS00028	Zinc finger
	IPR007087	348	368	PS00028	Zinc finger
	IPR007087	376	396	PS00028	Zinc finger
	IPR007087	404	424	PS00028	Zinc finger
	IPR007087	432	452	PS00028	Zinc finger
	IPR007087	460	480	PS00028	Zinc finger
	IPR007087	488	508	PS00028	Zinc finger
	IPR007087	516	536	PS00028	Zinc finger
	IPR007087	544	564	PS00028	Zinc finger
	IPR007087	572	592	PS00028	Zinc finger
	IPR007087	600	620	PS00028	Zinc finger
	IPR007087	628	648	PS00028	Zinc finger
	IPR007087	656	676	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp