Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11808
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11808
Clone name fh09886
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol HDGFRP3
cDNA sequence DNA sequence (5770 bp)
Predicted protein sequence (204 aa)
Flexi ORF Clone FXC11808
Description Hepatoma-derived growth factor-related protein 3 (HRP-3)(Hepatoma-derived growth factor 2)
Features of the cloned cDNA sequence

Length: 5770 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 5155 bp
Genome contig ID gi51511731r_81494279
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
GTCACATTGTTAGAGCTCAATAAACGTTCAACAAC
Flanking genome sequence
(99597 - 99548)
----+----*----+----*----+----*----+----*----+----*
AATGGACTTGTGACTGTCAAAATACAAAAAGGGTCTACAAAGCATTTCTC

Features of the protein sequence

Length: 204 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9Y3E1 4.3e-73 100.0 Hepatoma-derive...
Homo sapiens
XP_001111693 9.1e-73 100.0 hepatoma-derive...
Macaca mulatta
XP_001790340 9.6e-73 99.5 similar to Hepa...
Bos taurus
BAA90478 3.3e-71 98.0 hepatoma-derive...
Mus musculus
XP_001365929 4.3e-71 97.5 similar to CGI-...
Monodelphis dom...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000313 9 81 PF00855 PWWP
HMMSmart IPR000313 10 67 SM00293 PWWP
ProfileScan IPR000313 12 69 PS50812 PWWP
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp