ORK11810

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11810

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11810
Clone name	fh26309
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	STARD13
cDNA sequence	DNA sequence (5791 bp) Predicted protein sequence (1076 aa)
Description	StAR-related lipid transfer protein 13 (START domain-containing protein 13)(StARD13)(Deleted in liver cancer protein 2)(Rho GTPase-activating protein)(46H23.2)

Features of the cloned cDNA sequence

Description

Length: 5791 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2432 bp
Genome contig ID	gi51511729r_32475298
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AAATAATTGCCAAGGCAAATAAATTTATATATATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATATTTCCTATTTTCTATAAAATAGATGTTGATTTTCATGCTTCATCT

Features of the protein sequence

Description

Length: 1076 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y3M8	99.8	StAR-related li...	Homo sapiens
CAI46026	99.3	hypothetical pr...	Homo sapiens
AAL91649	99.7	deleted in live...	Homo sapiens
AAQ72791	99.5	Rho GTPase acti...	Homo sapiens
XP_001144512	99.6	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011510	23	85	PF07647	Sterile alpha motif homology 2
	IPR000198	640	786	PF00620	RhoGAP
	IPR002913	871	1071	PF01852	Lipid-binding START
HMMSmart	IPR000198	637	828	SM00324	RhoGAP
HMMSmart	IPR002913	871	1073	SM00234	Lipid-binding START
ProfileScan	IPR000198	626	831	PS50238	RhoGAP
ProfileScan	IPR002913	877	1045	PS50848	Lipid-binding START

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp