ORK11815

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11815

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11815
Clone name	fj12313
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	KCTD7
cDNA sequence	DNA sequence (4807 bp) Predicted protein sequence (310 aa)
Description	BTB/POZ domain-containing protein KCTD7

Features of the cloned cDNA sequence

Description

Length: 4807 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3815 bp
Genome contig ID	gi89161213f_65631365
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- CAGTACACTCCAAGGGCATTAAAGTCAAGAACTAG
Flanking genome sequence (114104 - 114153)	----+--------+--------+--------+--------+----* AACCTGGGTGCTGTGCCTTTCTTTTTTAGAGATGTGCTCTCATCTCTTCT

Features of the protein sequence

Description

Length: 310 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001069104	1e-123	95.4	similar to pota...	Rattus norvegicus
Q96MP8	2e-122	100.0	BTB/POZ domain-...	Homo sapiens
AAH42482	1.9e-121	100.0	KCTD7 protein [...	Homo sapiens
XP_848588	4.6e-120	98.2	similar to pota...	Canis lupus fam...
A4IFB4	7.2e-120	97.9	BTB/POZ domain-...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003131	74	162	PF02214	K+ channel tetramerisation
HMMSmart	IPR000210	72	170	SM00225	BTB/POZ-like

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp