Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11821
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11821
Clone name ha00180
Vector information
The cDNA fragment was cloned by use of ZAP-cDNA synthesis k ...
Symbol ZNF443
cDNA sequence DNA sequence (2626 bp)
Predicted protein sequence (680 aa)
Description Zinc finger protein 443 (Krueppel-type zinc finger protein ZK1)
Features of the cloned cDNA sequence

Length: 2626 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 449 bp
Genome contig ID gi42406306r_12301521
PolyA signal sequence
(ATTAAA,-26)		 
+----*----+----*----+----*----+----
AGCCAGAACATTAAAGTTTCTTTGTTTCAACTCTC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ACCTATTTCTTCTGTTTAATGTGTTAACACTTACCAAAACCCTGGGTCTT

Features of the protein sequence

Length: 680 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
NP_005806 0 99.8 zinc finger pro...
 Homo sapiens
EAW84273 0 99.7 zinc finger pro...
 Homo sapiens
Q9Y2A4 0 99.5 Zinc finger pro...
 Homo sapiens
BAG51151 0 98.8 unnamed protein...
 Homo sapiens
CAH90784 0 95.5 hypothetical pr...
 Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 206 229 PD000003 Zinc finger
IPR007087 234 257 PD000003 Zinc finger
IPR007087 262 285 PD000003 Zinc finger
IPR007087 290 313 PD000003 Zinc finger
IPR007087 318 341 PD000003 Zinc finger
IPR007087 346 369 PD000003 Zinc finger
IPR007087 374 397 PD000003 Zinc finger
IPR007087 402 425 PD000003 Zinc finger
IPR007087 430 453 PD000003 Zinc finger
IPR007087 458 481 PD000003 Zinc finger
IPR007087 513 536 PD000003 Zinc finger
IPR007087 541 564 PD000003 Zinc finger
IPR007087 569 591 PD000003 Zinc finger
IPR007087 597 620 PD000003 Zinc finger
IPR007087 658 680 PD000003 Zinc finger
HMMPfam IPR001909 13 53 PF01352 KRAB box
IPR007087 178 200 PF00096 Zinc finger
IPR007087 206 228 PF00096 Zinc finger
IPR007087 234 256 PF00096 Zinc finger
IPR007087 262 284 PF00096 Zinc finger
IPR007087 290 312 PF00096 Zinc finger
IPR007087 318 340 PF00096 Zinc finger
IPR007087 346 368 PF00096 Zinc finger
IPR007087 374 396 PF00096 Zinc finger
IPR007087 402 424 PF00096 Zinc finger
IPR007087 430 452 PF00096 Zinc finger
IPR007087 458 480 PF00096 Zinc finger
IPR007087 513 535 PF00096 Zinc finger
IPR007087 541 563 PF00096 Zinc finger
IPR007087 569 591 PF00096 Zinc finger
IPR007087 597 619 PF00096 Zinc finger
IPR007087 625 647 PF00096 Zinc finger
IPR007087 658 680 PF00096 Zinc finger
HMMSmart IPR001909 13 65 SM00349 KRAB box
IPR015880 140 172 SM00355 Zinc finger
IPR015880 178 198 SM00355 Zinc finger
IPR015880 206 228 SM00355 Zinc finger
IPR015880 234 256 SM00355 Zinc finger
IPR015880 262 284 SM00355 Zinc finger
IPR015880 290 312 SM00355 Zinc finger
IPR015880 318 340 SM00355 Zinc finger
IPR015880 346 368 SM00355 Zinc finger
IPR015880 374 396 SM00355 Zinc finger
IPR015880 402 424 SM00355 Zinc finger
IPR015880 430 452 SM00355 Zinc finger
IPR015880 458 480 SM00355 Zinc finger
IPR015880 486 507 SM00355 Zinc finger
IPR015880 513 535 SM00355 Zinc finger
IPR015880 541 563 SM00355 Zinc finger
IPR015880 569 591 SM00355 Zinc finger
IPR015880 597 619 SM00355 Zinc finger
IPR015880 625 647 SM00355 Zinc finger
IPR015880 658 680 SM00355 Zinc finger
ProfileScan IPR001909 13 95 PS50805 KRAB box
IPR007087 143 177 PS50157 Zinc finger
IPR007087 178 205 PS50157 Zinc finger
IPR007087 206 233 PS50157 Zinc finger
IPR007087 234 261 PS50157 Zinc finger
IPR007087 262 289 PS50157 Zinc finger
IPR007087 290 317 PS50157 Zinc finger
IPR007087 318 345 PS50157 Zinc finger
IPR007087 346 373 PS50157 Zinc finger
IPR007087 374 401 PS50157 Zinc finger
IPR007087 402 429 PS50157 Zinc finger
IPR007087 430 457 PS50157 Zinc finger
IPR007087 458 485 PS50157 Zinc finger
IPR007087 513 540 PS50157 Zinc finger
IPR007087 541 568 PS50157 Zinc finger
IPR007087 569 596 PS50157 Zinc finger
IPR007087 597 624 PS50157 Zinc finger
IPR007087 625 657 PS50157 Zinc finger
IPR007087 658 680 PS50157 Zinc finger
ScanRegExp IPR007087 208 228 PS00028 Zinc finger
IPR007087 236 256 PS00028 Zinc finger
IPR007087 264 284 PS00028 Zinc finger
IPR007087 292 312 PS00028 Zinc finger
IPR007087 320 340 PS00028 Zinc finger
IPR007087 348 368 PS00028 Zinc finger
IPR007087 376 396 PS00028 Zinc finger
IPR007087 404 424 PS00028 Zinc finger
IPR007087 432 452 PS00028 Zinc finger
IPR007087 460 480 PS00028 Zinc finger
IPR007087 515 535 PS00028 Zinc finger
IPR007087 543 563 PS00028 Zinc finger
IPR007087 571 591 PS00028 Zinc finger
IPR007087 599 619 PS00028 Zinc finger
IPR007087 627 647 PS00028 Zinc finger
IPR007087 660 680 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp