Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11822
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11822
Clone name ha01230
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of th ...
Symbol ZNF558
cDNA sequence DNA sequence (3581 bp)
Predicted protein sequence (443 aa)
Description Zinc finger protein 558
Features of the cloned cDNA sequence

Length: 3581 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1569 bp
Genome contig ID gi42406306r_8681388
PolyA signal sequence
(AATAAA,-22)		 
+----*----+----*----+----*----+----
AGCTGTTCCCTAAAATAAACATTAACATATTTCAT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AATTTTAATGCAATGTATTTATTATAATTAATTTGCTTGTTAAAGACATC

Features of the protein sequence

Length: 443 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96NG5 1.5e-168 99.7 Zinc finger pro...
 Homo sapiens
XP_001159901 6.3e-168 99.0 hypothetical pr...
 Pan troglodytes
XP_001101636 1.1e-164 96.7 similar to zinc...
 Macaca mulatta
XP_001495171 2.9e-140 85.5 similar to zinc...
 Equus caballus
BAH13534 1.8e-139 99.6 unnamed protein...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 194 216 PD000003 Zinc finger
IPR007087 221 243 PD000003 Zinc finger
IPR007087 249 272 PD000003 Zinc finger
IPR007087 278 300 PD000003 Zinc finger
IPR007087 305 328 PD000003 Zinc finger
IPR007087 333 356 PD000003 Zinc finger
IPR007087 361 384 PD000003 Zinc finger
IPR007087 389 412 PD000003 Zinc finger
IPR007087 417 439 PD000003 Zinc finger
HMMPfam IPR001909 84 124 PF01352 KRAB box
IPR007087 193 215 PF00096 Zinc finger
IPR007087 221 243 PF00096 Zinc finger
IPR007087 249 271 PF00096 Zinc finger
IPR007087 277 299 PF00096 Zinc finger
IPR007087 305 327 PF00096 Zinc finger
IPR007087 333 355 PF00096 Zinc finger
IPR007087 361 383 PF00096 Zinc finger
IPR007087 389 411 PF00096 Zinc finger
IPR007087 417 439 PF00096 Zinc finger
HMMSmart IPR001909 84 144 SM00349 KRAB box
IPR015880 193 215 SM00355 Zinc finger
IPR015880 221 243 SM00355 Zinc finger
IPR015880 249 271 SM00355 Zinc finger
IPR015880 277 299 SM00355 Zinc finger
IPR015880 305 327 SM00355 Zinc finger
IPR015880 333 355 SM00355 Zinc finger
IPR015880 361 383 SM00355 Zinc finger
IPR015880 389 411 SM00355 Zinc finger
IPR015880 417 439 SM00355 Zinc finger
ProfileScan IPR001909 84 155 PS50805 KRAB box
IPR007087 193 220 PS50157 Zinc finger
IPR007087 221 248 PS50157 Zinc finger
IPR007087 249 276 PS50157 Zinc finger
IPR007087 277 304 PS50157 Zinc finger
IPR007087 305 332 PS50157 Zinc finger
IPR007087 333 360 PS50157 Zinc finger
IPR007087 361 388 PS50157 Zinc finger
IPR007087 389 416 PS50157 Zinc finger
IPR007087 417 439 PS50157 Zinc finger
ScanRegExp IPR007087 195 215 PS00028 Zinc finger
IPR007087 223 243 PS00028 Zinc finger
IPR007087 251 271 PS00028 Zinc finger
IPR007087 279 299 PS00028 Zinc finger
IPR007087 307 327 PS00028 Zinc finger
IPR007087 335 355 PS00028 Zinc finger
IPR007087 363 383 PS00028 Zinc finger
IPR007087 391 411 PS00028 Zinc finger
IPR007087 419 439 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp