ORK11823

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11823

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11823
Clone name	ha03751
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of th ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	MERTK
cDNA sequence	DNA sequence (3667 bp) Predicted protein sequence (1054 aa)
HaloTag ORF Clone	FHC11823
Flexi ORF Clone	FXC11823
Description	Proto-oncogene tyrosine-protein kinase MER Precursor (C-mer)(EC 2.7.10.1)(Receptor tyrosine kinase MerTK)

Features of the cloned cDNA sequence

Description

Length: 3667 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	501 bp
Genome contig ID	gi89161199f_112272624
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TTCTGATATGGCTTCCTAATAAAATATGAATAAGG
Flanking genome sequence (230791 - 230840)	----+--------+--------+--------+--------+----* AAGGATATGTTGAACTTACTTGAGACTTGAAAGACAGTGGTCGGCAGCGG

Features of the protein sequence

Description

Length: 1054 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW52096	99.9	c-mer proto-onc...	Homo sapiens
Q12866	99.8	Tyrosine-protei...	Homo sapiens
BAG38172	99.7	unnamed protein...	Homo sapiens
AAB60430	98.8	novel cellular ...	Homo sapiens
AAG33129	99.7	MER receptor ty...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	601	640	PD008953	NULL
BlastProDom	IPR000719	656	902	PD000001	Protein kinase
FPrintScan	IPR001245	726	739	PR00109	Tyrosine protein kinase
	IPR001245	768	786	PR00109	Tyrosine protein kinase
	IPR001245	817	827	PR00109	Tyrosine protein kinase
	IPR001245	836	858	PR00109	Tyrosine protein kinase
	IPR001245	880	902	PR00109	Tyrosine protein kinase
HMMPfam	IPR013151	163	232	PF00047	Immunoglobulin
	IPR013151	266	319	PF00047	Immunoglobulin
	IPR003961	339	423	PF00041	Fibronectin
	IPR003961	438	528	PF00041	Fibronectin
	IPR001245	642	909	PF07714	Tyrosine protein kinase
HMMSmart	IPR003599	155	249	SM00409	Immunoglobulin subtype
	IPR003599	258	336	SM00409	Immunoglobulin subtype
	IPR003961	339	423	SM00060	Fibronectin
	IPR003961	439	525	SM00060	Fibronectin
	IPR001245	642	909	SM00219	Tyrosine protein kinase
	IPR002290	642	916	SM00220	Serine/threonine protein kinase
ProfileScan	IPR007110	136	241	PS50835	Immunoglobulin-like
	IPR007110	252	328	PS50835	Immunoglobulin-like
	IPR003961	339	434	PS50853	Fibronectin
	IPR003961	438	537	PS50853	Fibronectin
	IPR000719	642	913	PS50011	Protein kinase
ScanRegExp	IPR000719	648	674	PS00107	Protein kinase
ScanRegExp	IPR008266	774	786	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	557	VLIIFGCFCGFILIGLVLYISLA	579	PRIMARY	23