ORK11824

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11824

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11824
Clone name	ha06270s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	BCAR1
cDNA sequence	DNA sequence (3305 bp) Predicted protein sequence (942 aa)
HaloTag ORF Clone	FHC11824
Flexi ORF Clone	FXC11824
Description	Breast cancer anti-estrogen resistance protein 1 (CRK-associated substrate)(p130cas)(Cas scaffolding protein family member 1)

Features of the cloned cDNA sequence

Description

Length: 3305 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	474 bp
Genome contig ID	gi51511732r_73720436
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CTAAGAGTCTCCATTTAAATAAAGTTTTTAAAAGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGAGCAGCTGCCTGAGGGTGGCAGATGAGAGCAGCCCGGGGTGGGTGAC

Features of the protein sequence

Description

Length: 942 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG57215	97.3	unnamed protein...	Homo sapiens
P56945	100.0	Breast cancer a...	Homo sapiens
AAH62556	99.8	Breast cancer a...	Homo sapiens
NP_055382	99.8	breast cancer a...	Homo sapiens
EAW95651	98.3	breast cancer a...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	79	130	PD000066	Src homology-3
FPrintScan	IPR001452	78	88	PR00452	Src homology-3
	IPR001452	92	107	PR00452	Src homology-3
	IPR001452	326	338	PR00452	Src homology-3
HMMPfam	IPR001452	78	130	PF00018	Src homology-3
HMMPfam	IPR014928	526	682	PF08824	Serine rich protein interaction
HMMSmart	IPR001452	78	136	SM00326	Src homology-3
ProfileScan	IPR001452	75	137	PS50002	Src homology-3

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp