ORK11827

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11827

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11827
Clone name	ha06911
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	IDH3A
cDNA sequence	DNA sequence (2649 bp) Predicted protein sequence (370 aa)
HaloTag ORF Clone	FHC11827
Flexi ORF Clone	FXC11827
Description	Isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial Precursor (EC 1.1.1.41)(Isocitric dehydrogenase)(NAD(+)-specific ICDH)

Features of the cloned cDNA sequence

Description

Length: 2649 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1536 bp
Genome contig ID	gi51511731f_76128789
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TCTTGGGTTCAAAGTAATAAAGAATTCCAAAACTG
Flanking genome sequence (121151 - 121200)	----+--------+--------+--------+--------+----* AGATGTTTGCTTTCTCTACCTGTTTCCTGTTCAGATGCCTTCGGTCATTT

Features of the protein sequence

Description

Length: 370 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P50213	7.9e-153	100.0	Isocitrate dehy...	Homo sapiens
AAP36141	8e-153	100.0	isocitrate dehy...	synthetic construct
Q5R678	1.5e-152	99.7	Isocitrate dehy...	Pongo abelii
BAD96693	1.7e-152	99.7	isocitrate dehy...	Homo sapiens
XP_001927373	3.6e-150	98.0	similar to Isoc...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001804	37	362	PF00180	Isocitrate/isopropylmalate dehydrogenase
HMMTigr	IPR004434	33	366	TIGR00175	Isocitrate dehydrogenase NAD-dependent
ScanRegExp	IPR001804	257	276	PS00470	Isocitrate/isopropylmalate dehydrogenase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp