Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11828
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11828
Clone name hg00912
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZBTB9
cDNA sequence DNA sequence (6484 bp)
Predicted protein sequence (504 aa)
Description Zinc finger and BTB domain-containing protein 9
Features of the cloned cDNA sequence

Length: 6484 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1019 bp
Genome contig ID gi89161210f_33419491
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CTTAAAATTTTTTAATAAACTGTGCCCTGAAACCT
Flanking genome sequence
(113807 - 113856)
----+----*----+----*----+----*----+----*----+----*
AAACTGACAGTGGACTGGATTGAGTAATTTGTGTGGGAGAGAATGTGAGA

Features of the protein sequence

Length: 504 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96C00 1.7e-157 100.0 Zinc finger and...
Homo sapiens
BAG36344 8.8e-157 99.7 unnamed protein...
Homo sapiens
XP_001171244 1.2e-156 99.5 zinc finger and...
Pan troglodytes
XP_001116313 1e-152 97.8 similar to zinc...
Macaca mulatta
CAE83914 9.5e-114 76.5 gene correspond...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 442 464 PD000003 Zinc finger
HMMPfam IPR013069 69 173 PF00651 BTB/POZ
IPR007087 442 464 PF00096 Zinc finger
HMMSmart IPR000210 79 173 SM00225 BTB/POZ-like
IPR015880 442 464 SM00355 Zinc finger
IPR015880 469 489 SM00355 Zinc finger
ProfileScan IPR000210 79 143 PS50097 BTB/POZ-like
IPR007087 442 469 PS50157 Zinc finger
ScanRegExp IPR007087 444 464 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp