Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11831
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11831
Clone name hh00495
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF17
cDNA sequence DNA sequence (6087 bp)
Predicted protein sequence (698 aa)
Description Zinc finger protein 17 (Zinc finger protein KOX10)(HPF3)
Features of the cloned cDNA sequence

Length: 6087 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 3266 bp
Genome contig ID gi42406306f_62493137
PolyA signal sequence
(AATAAA,-32)		 
+----*----+----*----+----*----+----
AATAATAAAGCCATGTTTCATCTGTACAATTCTTC
Flanking genome sequence
(134792 - 134841)		 
----+----*----+----*----+----*----+----*----+----*
AAAGAAATGCTTCAGCATCTTGATCCTACTTGTTTAACATTTACATTGAA

Features of the protein sequence

Length: 698 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P17021 0 100.0 Zinc finger pro...
 Homo sapiens
EAW72500 0 99.3 zinc finger pro...
 Homo sapiens
BAG54604 0 99.2 unnamed protein...
 Homo sapiens
XP_524424 0 96.2 zinc finger pro...
 Pan troglodytes
XP_001092446 0 96.6 similar to zinc...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 226 249 PD000003 Zinc finger
IPR007087 254 277 PD000003 Zinc finger
IPR007087 282 305 PD000003 Zinc finger
IPR007087 310 333 PD000003 Zinc finger
IPR007087 338 361 PD000003 Zinc finger
IPR007087 366 389 PD000003 Zinc finger
IPR007087 394 417 PD000003 Zinc finger
IPR007087 422 445 PD000003 Zinc finger
IPR007087 450 473 PD000003 Zinc finger
IPR007087 478 501 PD000003 Zinc finger
IPR007087 506 529 PD000003 Zinc finger
IPR007087 534 557 PD000003 Zinc finger
IPR007087 590 613 PD000003 Zinc finger
IPR007087 618 641 PD000003 Zinc finger
IPR007087 646 669 PD000003 Zinc finger
IPR007087 674 697 PD000003 Zinc finger
HMMPfam IPR001909 44 84 PF01352 KRAB box
IPR007087 226 248 PF00096 Zinc finger
IPR007087 254 276 PF00096 Zinc finger
IPR007087 282 304 PF00096 Zinc finger
IPR007087 310 332 PF00096 Zinc finger
IPR007087 338 360 PF00096 Zinc finger
IPR007087 366 388 PF00096 Zinc finger
IPR007087 394 416 PF00096 Zinc finger
IPR007087 422 444 PF00096 Zinc finger
IPR007087 450 472 PF00096 Zinc finger
IPR007087 478 500 PF00096 Zinc finger
IPR007087 506 528 PF00096 Zinc finger
IPR007087 534 556 PF00096 Zinc finger
IPR007087 562 584 PF00096 Zinc finger
IPR007087 590 612 PF00096 Zinc finger
IPR007087 618 640 PF00096 Zinc finger
IPR007087 646 668 PF00096 Zinc finger
IPR007087 674 696 PF00096 Zinc finger
HMMSmart IPR001909 44 104 SM00349 KRAB box
IPR015880 120 142 SM00355 Zinc finger
IPR015880 226 248 SM00355 Zinc finger
IPR015880 254 276 SM00355 Zinc finger
IPR015880 282 304 SM00355 Zinc finger
IPR015880 310 332 SM00355 Zinc finger
IPR015880 338 360 SM00355 Zinc finger
IPR015880 366 388 SM00355 Zinc finger
IPR015880 394 416 SM00355 Zinc finger
IPR015880 422 444 SM00355 Zinc finger
IPR015880 450 472 SM00355 Zinc finger
IPR015880 478 500 SM00355 Zinc finger
IPR015880 506 528 SM00355 Zinc finger
IPR015880 534 556 SM00355 Zinc finger
IPR015880 562 584 SM00355 Zinc finger
IPR015880 590 612 SM00355 Zinc finger
IPR015880 618 640 SM00355 Zinc finger
IPR015880 646 668 SM00355 Zinc finger
IPR015880 674 696 SM00355 Zinc finger
ProfileScan IPR001909 44 137 PS50805 KRAB box
IPR007087 226 253 PS50157 Zinc finger
IPR007087 254 281 PS50157 Zinc finger
IPR007087 282 309 PS50157 Zinc finger
IPR007087 310 337 PS50157 Zinc finger
IPR007087 338 365 PS50157 Zinc finger
IPR007087 366 393 PS50157 Zinc finger
IPR007087 394 421 PS50157 Zinc finger
IPR007087 422 449 PS50157 Zinc finger
IPR007087 450 477 PS50157 Zinc finger
IPR007087 478 505 PS50157 Zinc finger
IPR007087 506 533 PS50157 Zinc finger
IPR007087 534 561 PS50157 Zinc finger
IPR007087 562 589 PS50157 Zinc finger
IPR007087 590 617 PS50157 Zinc finger
IPR007087 618 645 PS50157 Zinc finger
IPR007087 646 673 PS50157 Zinc finger
IPR007087 674 698 PS50157 Zinc finger
ScanRegExp IPR007087 122 142 PS00028 Zinc finger
IPR007087 228 248 PS00028 Zinc finger
IPR007087 256 276 PS00028 Zinc finger
IPR007087 284 304 PS00028 Zinc finger
IPR007087 312 332 PS00028 Zinc finger
IPR007087 340 360 PS00028 Zinc finger
IPR007087 368 388 PS00028 Zinc finger
IPR007087 396 416 PS00028 Zinc finger
IPR007087 424 444 PS00028 Zinc finger
IPR007087 452 472 PS00028 Zinc finger
IPR007087 480 500 PS00028 Zinc finger
IPR007087 508 528 PS00028 Zinc finger
IPR007087 536 556 PS00028 Zinc finger
IPR007087 564 584 PS00028 Zinc finger
IPR007087 592 612 PS00028 Zinc finger
IPR007087 620 640 PS00028 Zinc finger
IPR007087 648 668 PS00028 Zinc finger
IPR007087 676 696 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp