Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11833
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11833
Clone name hh13727
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF582
cDNA sequence DNA sequence (5766 bp)
Predicted protein sequence (551 aa)
Flexi ORF Clone FXC11833
Description Zinc finger protein 582
Features of the cloned cDNA sequence

Length: 5766 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3881 bp
Genome contig ID gi42406306r_61483629
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
ACTCCATCCTGGGTGACAGAGCAAGACTCCGTCTC
Flanking genome sequence
(99534 - 99485)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAGAAAAAAAAAAAATTTAAGAAATCTGTATGACAACT

Features of the protein sequence

Length: 551 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW72447 0 99.6 zinc finger pro...
 Homo sapiens
BAH14399 0 98.5 unnamed protein...
 Homo sapiens
XP_001094946 0 96.1 similar to zinc...
 Macaca mulatta
Q96NG8 0 99.6 Zinc finger pro...
 Homo sapiens
XP_524408 0 99.0 hypothetical pr...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 233 256 PD000003 Zinc finger
IPR007087 261 284 PD000003 Zinc finger
IPR007087 289 312 PD000003 Zinc finger
IPR007087 317 340 PD000003 Zinc finger
IPR007087 345 368 PD000003 Zinc finger
IPR007087 373 396 PD000003 Zinc finger
IPR007087 401 424 PD000003 Zinc finger
IPR007087 429 452 PD000003 Zinc finger
IPR007087 457 480 PD000003 Zinc finger
HMMPfam IPR001909 42 80 PF01352 KRAB box
IPR007087 233 255 PF00096 Zinc finger
IPR007087 261 283 PF00096 Zinc finger
IPR007087 289 311 PF00096 Zinc finger
IPR007087 317 339 PF00096 Zinc finger
IPR007087 345 367 PF00096 Zinc finger
IPR007087 373 395 PF00096 Zinc finger
IPR007087 401 423 PF00096 Zinc finger
IPR007087 429 451 PF00096 Zinc finger
IPR007087 457 479 PF00096 Zinc finger
HMMSmart IPR001909 42 100 SM00349 KRAB box
IPR015880 233 255 SM00355 Zinc finger
IPR015880 261 283 SM00355 Zinc finger
IPR015880 289 311 SM00355 Zinc finger
IPR015880 317 339 SM00355 Zinc finger
IPR015880 345 367 SM00355 Zinc finger
IPR015880 373 395 SM00355 Zinc finger
IPR015880 401 423 SM00355 Zinc finger
IPR015880 429 451 SM00355 Zinc finger
IPR015880 457 479 SM00355 Zinc finger
ProfileScan IPR001909 40 111 PS50805 KRAB box
IPR007087 205 232 PS50157 Zinc finger
IPR007087 233 260 PS50157 Zinc finger
IPR007087 261 288 PS50157 Zinc finger
IPR007087 289 316 PS50157 Zinc finger
IPR007087 317 344 PS50157 Zinc finger
IPR007087 345 372 PS50157 Zinc finger
IPR007087 373 400 PS50157 Zinc finger
IPR007087 401 428 PS50157 Zinc finger
IPR007087 429 456 PS50157 Zinc finger
IPR007087 457 484 PS50157 Zinc finger
ScanRegExp IPR007087 235 255 PS00028 Zinc finger
IPR007087 263 283 PS00028 Zinc finger
IPR007087 291 311 PS00028 Zinc finger
IPR007087 319 339 PS00028 Zinc finger
IPR007087 347 367 PS00028 Zinc finger
IPR007087 375 395 PS00028 Zinc finger
IPR007087 403 423 PS00028 Zinc finger
IPR007087 431 451 PS00028 Zinc finger
IPR007087 459 479 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp