ORK11834

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11834

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11834
Clone name	hj02537
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MPP7
cDNA sequence	DNA sequence (4941 bp) Predicted protein sequence (583 aa)
HaloTag ORF Clone	FHC11834
Flexi ORF Clone	FXC11834
Description	MAGUK p55 subfamily member 7

Features of the cloned cDNA sequence

Description

Length: 4941 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2887 bp
Genome contig ID	gi89161187r_28280113
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GAAAAATCTTTGATCTTAATAAAGTACCTTCAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTGTGTGTACTTACTTGAAAATTGTTTTTGCACTTGGATATTCTATTTT

Features of the protein sequence

Description

Length: 583 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH38105	100.0	MPP7 protein [H...	Homo sapiens
Q5T2T1	99.8	MAGUK p55 subfa...	Homo sapiens
BAG51907	99.8	unnamed protein...	Homo sapiens
XP_001160987	99.8	palmitoylated m...	Pan troglodytes
XP_001105654	98.9	similar to palm...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	238	297	PD000066	Src homology-3
FPrintScan	IPR001452	238	248	PR00452	Src homology-3
	IPR001452	259	274	PR00452	Src homology-3
	IPR001452	276	285	PR00452	Src homology-3
	IPR001452	291	303	PR00452	Src homology-3
HMMPfam	IPR014775	17	75	PF02828	L27
	IPR014775	79	132	PF02828	L27
	IPR001478	146	224	PF00595	PDZ/DHR/GLGF
	IPR011511	239	303	PF07653	Variant SH3
	IPR008144	411	511	PF00625	Guanylate kinase
HMMSmart	IPR004172	17	75	SM00569	L27
	IPR004172	79	132	SM00569	L27
	IPR001478	154	227	SM00228	PDZ/DHR/GLGF
	IPR001452	238	304	SM00326	Src homology-3
	IPR008145	374	570	SM00072	Guanylate kinase/L-type calcium channel region
ProfileScan	IPR004172	17	72	PS51022	L27
	IPR004172	74	129	PS51022	L27
	IPR001478	146	227	PS50106	PDZ/DHR/GLGF
	IPR001452	235	305	PS50002	Src homology-3
	IPR008144	375	567	PS50052	Guanylate kinase
ScanRegExp	IPR008144	410	427	PS00856	Guanylate kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp