ORK11836

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11836

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11836
Clone name	hj08012
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ERBB2
cDNA sequence	DNA sequence (4577 bp) Predicted protein sequence (1353 aa)
HaloTag ORF Clone	FHC11836
Flexi ORF Clone	FXC11836
Description	Receptor tyrosine-protein kinase erbB-2 Precursor (EC 2.7.10.1)(p185erbB2)(C-erbB-2)(NEU proto-oncogene)(Tyrosine kinase-type cell surface receptor HER2)(MLN 19)(CD340 antigen)

Features of the cloned cDNA sequence

Description

Length: 4577 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	514 bp
Genome contig ID	gi51511734f_35009723
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTACTTTTTTTGTTTTGTTTTTTTAAAGATGAAA
Flanking genome sequence (128616 - 128665)	----+--------+--------+--------+--------+----* TAAAGACCCAGGGGGAGAATGGGTGTTGTATGGGGAGGCAAGTGTGGGGG

Features of the protein sequence

Description

Length: 1353 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P04626	100.0	Receptor tyrosi...	Homo sapiens
AAX40997	100.0	v-erb-b2 erythr...	synthetic construct
AAO18082	99.9	v-erb-b2 erythr...	Homo sapiens
AAA75493	99.8	HER2 receptor [...	Homo sapiens
BAG58195	99.4	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	822	1081	PD000001	Protein kinase
FPrintScan	IPR001245	896	909	PR00109	Tyrosine protein kinase
	IPR001245	933	951	PR00109	Tyrosine protein kinase
	IPR001245	982	992	PR00109	Tyrosine protein kinase
	IPR001245	1001	1023	PR00109	Tyrosine protein kinase
	IPR001245	1045	1067	PR00109	Tyrosine protein kinase
HMMPfam	IPR000494	150	271	PF01030	EGF receptor
	IPR006211	287	441	PF00757	Furin-like cysteine rich region
	IPR000494	464	584	PF01030	EGF receptor
	IPR001245	818	1074	PF07714	Tyrosine protein kinase
	IPR004019	1118	1126	PF02757	YLP motif
	IPR004019	1291	1299	PF02757	YLP motif
HMMSmart	IPR006212	330	373	SM00261	Furin-like repeat
	IPR006212	599	650	SM00261	Furin-like repeat
	IPR006212	655	704	SM00261	Furin-like repeat
	IPR001245	818	1074	SM00219	Tyrosine protein kinase
	IPR002290	818	1075	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	818	1085	PS50011	Protein kinase
ScanRegExp	IPR000719	824	851	PS00107	Protein kinase
	IPR008266	939	951	PS00109	Tyrosine protein kinase
	IPR002048	1109	1121	PS00018	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	750	TSIISAVVGILLVVVLGVVFGIL	772	PRIMARY	23