Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11837
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11837
Clone name hk00353
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF197
cDNA sequence DNA sequence (3924 bp)
Predicted protein sequence (1049 aa)
Flexi ORF Clone FXC11837
Description Zinc finger protein 197 (ZnF20)(Zinc finger protein with KRAB and SCAN domains 9)
Features of the cloned cDNA sequence

Length: 3924 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 661 bp
Genome contig ID gi89161205f_44541548
PolyA signal sequence
(AATAAA,-6)		 
+----*----+----*----+----*----+----
CGTCTTTAGTAAATAAAAATAAATTTATTAATAAA
Flanking genome sequence
(119831 - 119880)		 
----+----*----+----*----+----*----+----*----+----*
ACTAAAAATTTAATAATAAAAAGTGGACATTGTTTTTTAAAATGTGTATA

Features of the protein sequence

Length: 1049 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O14709 0 100.0 Zinc finger pro...
 Homo sapiens
XP_001105310 0 97.9 zinc finger pro...
 Macaca mulatta
XP_001916854 0 93.4 similar to Zinc...
 Equus caballus
XP_548542 0 91.9 similar to Zinc...
 Canis lupus fam...
XP_856350 0 89.3 similar to Zinc...
 Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 390 413 PD000003 Zinc finger
IPR007087 418 438 PD000003 Zinc finger
IPR007087 446 469 PD000003 Zinc finger
IPR007087 474 497 PD000003 Zinc finger
IPR007087 502 524 PD000003 Zinc finger
IPR007087 558 581 PD000003 Zinc finger
IPR007087 586 609 PD000003 Zinc finger
IPR007087 642 664 PD000003 Zinc finger
IPR007087 670 693 PD000003 Zinc finger
IPR007087 698 720 PD000003 Zinc finger
IPR007087 754 777 PD000003 Zinc finger
IPR007087 782 805 PD000003 Zinc finger
IPR007087 810 833 PD000003 Zinc finger
IPR007087 838 861 PD000003 Zinc finger
IPR007087 866 889 PD000003 Zinc finger
IPR007087 922 945 PD000003 Zinc finger
IPR007087 950 973 PD000003 Zinc finger
IPR007087 978 1001 PD000003 Zinc finger
HMMPfam IPR003309 56 151 PF02023 Transcriptional regulator SCAN
IPR001909 237 277 PF01352 KRAB box
IPR007087 418 440 PF00096 Zinc finger
IPR007087 446 468 PF00096 Zinc finger
IPR007087 474 496 PF00096 Zinc finger
IPR007087 502 524 PF00096 Zinc finger
IPR007087 530 552 PF00096 Zinc finger
IPR007087 558 580 PF00096 Zinc finger
IPR007087 586 608 PF00096 Zinc finger
IPR007087 614 636 PF00096 Zinc finger
IPR007087 642 664 PF00096 Zinc finger
IPR007087 670 692 PF00096 Zinc finger
IPR007087 698 720 PF00096 Zinc finger
IPR007087 726 748 PF00096 Zinc finger
IPR007087 754 776 PF00096 Zinc finger
IPR007087 782 804 PF00096 Zinc finger
IPR007087 810 832 PF00096 Zinc finger
IPR007087 838 860 PF00096 Zinc finger
IPR007087 866 888 PF00096 Zinc finger
IPR007087 894 916 PF00096 Zinc finger
IPR007087 922 944 PF00096 Zinc finger
IPR007087 950 972 PF00096 Zinc finger
IPR007087 978 1000 PF00096 Zinc finger
HMMSmart IPR003309 58 170 SM00431 Transcriptional regulator SCAN
IPR001909 237 293 SM00349 KRAB box
IPR015880 390 412 SM00355 Zinc finger
IPR015880 418 440 SM00355 Zinc finger
IPR015880 446 468 SM00355 Zinc finger
IPR015880 474 496 SM00355 Zinc finger
IPR015880 502 524 SM00355 Zinc finger
IPR015880 530 552 SM00355 Zinc finger
IPR015880 558 580 SM00355 Zinc finger
IPR015880 586 608 SM00355 Zinc finger
IPR015880 614 636 SM00355 Zinc finger
IPR015880 642 664 SM00355 Zinc finger
IPR015880 670 692 SM00355 Zinc finger
IPR015880 698 720 SM00355 Zinc finger
IPR015880 726 748 SM00355 Zinc finger
IPR015880 754 776 SM00355 Zinc finger
IPR015880 782 804 SM00355 Zinc finger
IPR015880 810 832 SM00355 Zinc finger
IPR015880 838 860 SM00355 Zinc finger
IPR015880 866 888 SM00355 Zinc finger
IPR015880 894 916 SM00355 Zinc finger
IPR015880 922 944 SM00355 Zinc finger
IPR015880 950 972 SM00355 Zinc finger
IPR015880 978 1000 SM00355 Zinc finger
ProfileScan IPR003309 62 144 PS50804 Transcriptional regulator SCAN
IPR001909 237 309 PS50805 KRAB box
IPR007087 390 417 PS50157 Zinc finger
IPR007087 418 445 PS50157 Zinc finger
IPR007087 446 473 PS50157 Zinc finger
IPR007087 474 501 PS50157 Zinc finger
IPR007087 502 529 PS50157 Zinc finger
IPR007087 530 557 PS50157 Zinc finger
IPR007087 558 585 PS50157 Zinc finger
IPR007087 586 613 PS50157 Zinc finger
IPR007087 614 641 PS50157 Zinc finger
IPR007087 642 669 PS50157 Zinc finger
IPR007087 670 697 PS50157 Zinc finger
IPR007087 698 725 PS50157 Zinc finger
IPR007087 726 753 PS50157 Zinc finger
IPR007087 754 781 PS50157 Zinc finger
IPR007087 782 809 PS50157 Zinc finger
IPR007087 810 837 PS50157 Zinc finger
IPR007087 838 865 PS50157 Zinc finger
IPR007087 866 893 PS50157 Zinc finger
IPR007087 894 921 PS50157 Zinc finger
IPR007087 922 949 PS50157 Zinc finger
IPR007087 950 977 PS50157 Zinc finger
IPR007087 978 1005 PS50157 Zinc finger
ScanRegExp IPR007087 392 412 PS00028 Zinc finger
IPR007087 420 440 PS00028 Zinc finger
IPR007087 448 468 PS00028 Zinc finger
IPR007087 476 496 PS00028 Zinc finger
IPR007087 504 524 PS00028 Zinc finger
IPR007087 532 552 PS00028 Zinc finger
IPR007087 560 580 PS00028 Zinc finger
IPR007087 588 608 PS00028 Zinc finger
IPR007087 616 636 PS00028 Zinc finger
IPR007087 644 664 PS00028 Zinc finger
IPR007087 672 692 PS00028 Zinc finger
IPR007087 700 720 PS00028 Zinc finger
IPR007087 728 748 PS00028 Zinc finger
IPR007087 756 776 PS00028 Zinc finger
IPR007087 784 804 PS00028 Zinc finger
IPR007087 812 832 PS00028 Zinc finger
IPR007087 840 860 PS00028 Zinc finger
IPR007087 868 888 PS00028 Zinc finger
IPR007087 896 916 PS00028 Zinc finger
IPR007087 924 944 PS00028 Zinc finger
IPR007087 952 972 PS00028 Zinc finger
IPR007087 980 1000 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp