ORK11846

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11846

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11846
Clone name	bm04288
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	DDX41
cDNA sequence	DNA sequence (2069 bp) Predicted protein sequence (617 aa)
HaloTag ORF Clone	FHC11846
Flexi ORF Clone	FXC11846
Description	Probable ATP-dependent RNA helicase DDX41 (EC 3.6.1.-)(DEAD box protein 41)(DEAD box protein abstrakt homolog)

Features of the cloned cDNA sequence

Description

Length: 2069 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	213 bp
Genome contig ID	gi51511721r_176771185
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- ACCCCAGCTGCCATTAAAGCCCAAACCTCTAGCCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCCCTGGCCCTGCCTCTGTGTTTCACCTCATCCGCCCCCTGGTTCCTGG

Features of the protein sequence

Description

Length: 617 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UJV9	100.0	Probable ATP-de...	Homo sapiens
AAP36251	100.0	DEAD-box protei...	synthetic construct
BAD96318	99.8	DEAD-box protei...	Homo sapiens
XP_001092587	99.6	DEAD-box protei...	Macaca mulatta
BAB55355	99.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	200	380	PF00270	DNA/RNA helicase
	IPR001650	446	522	PF00271	DNA/RNA helicase
	IPR001878	575	592	PF00098	Zinc finger
HMMSmart	IPR014001	195	406	SM00487	DEAD-like helicases
HMMSmart	IPR001650	441	522	SM00490	DNA/RNA helicase
ProfileScan	IPR014014	176	204	PS51195	RNA helicase
	IPR014021	207	391	PS51192	Helicase
	IPR001650	402	562	PS51194	DNA/RNA helicase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp