ORK11849

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11849

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11849
Clone name	ee09753
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	KAT2A
cDNA sequence	DNA sequence (3045 bp) Predicted protein sequence (836 aa)
Description	General control of amino acid synthesis protein 5-like 2 (EC 2.3.1.48)(Histone acetyltransferase GCN5)(hsGCN5)(STAF97)

Features of the cloned cDNA sequence

Description

Length: 3045 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	534 bp
Genome contig ID	gi51511734r_37418659
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TCCCTTAGAGGGAATAATAAAGCTTTTTATTTCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGTGTGATTGTTTCTTTGGTGTAGTCCCAGCCTTAGCAGGCTCACCTTGG

Features of the protein sequence

Description

Length: 836 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92830	100.0	Histone acetylt...	Homo sapiens
EAW60802	99.8	GCN5 general co...	Homo sapiens
AAC39769	99.6	hGCN5 [Homo sap...	Homo sapiens
XP_511500	99.5	GCN5 general co...	Pan troglodytes
XP_548094	98.4	similar to GCN5...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001487	747	760	PR00503	Bromodomain
	IPR001487	761	777	PR00503	Bromodomain
	IPR001487	777	795	PR00503	Bromodomain
	IPR001487	795	814	PR00503	Bromodomain
HMMPfam	IPR009464	86	336	PF06466	PCAF
	IPR000182	550	627	PF00583	GCN5-related N-acetyltransferase
	IPR001487	732	819	PF00439	Bromodomain
HMMSmart	IPR001487	725	833	SM00297	Bromodomain
ProfileScan	IPR000182	502	655	PS51186	GCN5-related N-acetyltransferase
ProfileScan	IPR001487	744	814	PS50014	Bromodomain
ScanRegExp	IPR001487	749	806	PS00633	Bromodomain

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp