Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11850
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11850
Clone name ef03961
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol RNF114
cDNA sequence DNA sequence (2418 bp)
Predicted protein sequence (226 aa)
Flexi ORF Clone FXC11850
Description RING finger protein 114 (Zinc finger protein 313)
Features of the cloned cDNA sequence

Length: 2418 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1736 bp
Genome contig ID gi51511747f_47886362
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
TTTAAAAGGTAAAATATAAATAAATTTCATAACTT
Flanking genome sequence
(117462 - 117511)
----+----*----+----*----+----*----+----*----+----*
AATCTAAGTGGTAAGCTATGGTTCTTGTTTTCATTCAACACATTTGCCAT

Features of the protein sequence

Length: 226 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9Y508 1.2e-98 100.0 RING finger pro...
Homo sapiens
AAP36432 1.2e-98 100.0 zinc finger pro...
synthetic construct
Q6J212 3.4e-98 99.5 RING finger pro...
Pan troglodytes
CAE45709 5.3e-97 98.2 hypothetical pr...
Homo sapiens
BAE02323 6.1e-97 98.6 unnamed protein...
Macaca fascicularis
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001841 27 65 PF00097 Zinc finger
HMMSmart IPR001841 27 65 SM00184 Zinc finger
ProfileScan IPR001841 27 66 PS50089 Zinc finger
ScanRegExp IPR001841 42 51 PS00518 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp