Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11851
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11851
Clone name fh12350
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZNF223
cDNA sequence DNA sequence (5250 bp)
Predicted protein sequence (477 aa)
Description Zinc finger protein 223
Features of the cloned cDNA sequence

Length: 5250 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 171 bp
Genome contig ID gi42406306f_49152888
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTCCAGCAGTTTGAAAATAAATTGTTGTCGATGAT
Flanking genome sequence
(110555 - 110604)
----+----*----+----*----+----*----+----*----+----*
AGTCACCTTTAGTGCTGCAGAACAGCAGAACTTCTTCCTCTTATCTACCT

Features of the protein sequence

Length: 477 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH22466 2.1e-211 100.0 Zinc finger pro...
Homo sapiens
EAW57248 3.3e-211 99.7 zinc finger pro...
Homo sapiens
EAW57245 3.4e-211 99.7 zinc finger pro...
Homo sapiens
XP_513000 9.4e-209 98.9 zinc finger pro...
Pan troglodytes
XP_001108165 5.1e-200 94.6 similar to zinc...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 171 193 PD000003 Zinc finger
IPR007087 199 222 PD000003 Zinc finger
IPR007087 227 249 PD000003 Zinc finger
IPR007087 255 278 PD000003 Zinc finger
IPR007087 339 362 PD000003 Zinc finger
IPR007087 367 390 PD000003 Zinc finger
IPR007087 395 417 PD000003 Zinc finger
HMMPfam IPR001909 3 43 PF01352 KRAB box
IPR007087 171 193 PF00096 Zinc finger
IPR007087 199 221 PF00096 Zinc finger
IPR007087 227 249 PF00096 Zinc finger
IPR007087 255 277 PF00096 Zinc finger
IPR007087 283 305 PF00096 Zinc finger
IPR007087 339 361 PF00096 Zinc finger
IPR007087 367 389 PF00096 Zinc finger
IPR007087 395 417 PF00096 Zinc finger
HMMSmart IPR001909 3 62 SM00349 KRAB box
IPR015880 171 193 SM00355 Zinc finger
IPR015880 199 221 SM00355 Zinc finger
IPR015880 227 249 SM00355 Zinc finger
IPR015880 255 277 SM00355 Zinc finger
IPR015880 283 305 SM00355 Zinc finger
IPR015880 339 361 SM00355 Zinc finger
IPR015880 367 389 SM00355 Zinc finger
IPR015880 395 417 SM00355 Zinc finger
IPR015880 423 445 SM00355 Zinc finger
ProfileScan IPR001909 3 73 PS50805 KRAB box
IPR007087 171 198 PS50157 Zinc finger
IPR007087 199 226 PS50157 Zinc finger
IPR007087 227 254 PS50157 Zinc finger
IPR007087 255 282 PS50157 Zinc finger
IPR007087 283 310 PS50157 Zinc finger
IPR007087 317 338 PS50157 Zinc finger
IPR007087 339 366 PS50157 Zinc finger
IPR007087 367 394 PS50157 Zinc finger
IPR007087 395 422 PS50157 Zinc finger
IPR007087 423 450 PS50157 Zinc finger
ScanRegExp IPR007087 173 193 PS00028 Zinc finger
IPR007087 201 221 PS00028 Zinc finger
IPR007087 229 249 PS00028 Zinc finger
IPR007087 257 277 PS00028 Zinc finger
IPR007087 285 305 PS00028 Zinc finger
IPR007087 341 361 PS00028 Zinc finger
IPR007087 369 389 PS00028 Zinc finger
IPR007087 397 417 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp