ORK11859

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11859

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11859
Clone name	ef05920s1
Vector information	The cDNA fragment was inserted at the XhoI-NotI site of the ... The cDNA fragment was inserted at the XhoI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: CCCCCCCTCG AGCAGCTGAA GCTTTCACAA GTTTGTACAA AAAAGCAGGC TCTTC-5' end of cDNA
Symbol	FLT1
cDNA sequence	DNA sequence (7254 bp) Predicted protein sequence (1450 aa)
Description	fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)

Features of the cloned cDNA sequence

Description

Length: 7254 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2814 bp
Genome contig ID	gi51511729r_27672484
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TATACCATCTTCATATAATAAACTTCCAAAAACAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATATATTTTCTCCCTGATTTGCTTGTTAAGTGTAAAAAAGAGGTCACAGG

Features of the protein sequence

Description

Length: 1450 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001117928	96.8	fms-related tyr...	Macaca mulatta
BAG11047	100.0	vascular endoth...	synthetic construct
P17948	99.9	Vascular endoth...	Homo sapiens
CAA35946	99.8	unnamed protein...	Homo sapiens
AAC16449	99.8	vascular endoth...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	941	1037	PD000001	Protein kinase
BlastProDom	IPR000719	1105	1271	PD000001	Protein kinase
FPrintScan	IPR009135	138	153	PR01833	Vascular endothelial growth factor receptor 1
	IPR009135	191	205	PR01833	Vascular endothelial growth factor receptor 1
	IPR009134	201	219	PR01832	Vascular endothelial growth factor receptor
	IPR009134	237	248	PR01832	Vascular endothelial growth factor receptor
	IPR009135	242	267	PR01833	Vascular endothelial growth factor receptor 1
	IPR009134	296	306	PR01832	Vascular endothelial growth factor receptor
	IPR009135	336	359	PR01833	Vascular endothelial growth factor receptor 1
	IPR009134	354	366	PR01832	Vascular endothelial growth factor receptor
	IPR009135	385	402	PR01833	Vascular endothelial growth factor receptor 1
	IPR009135	462	482	PR01833	Vascular endothelial growth factor receptor 1
	IPR009135	487	501	PR01833	Vascular endothelial growth factor receptor 1
	IPR009134	502	519	PR01832	Vascular endothelial growth factor receptor
	IPR009134	560	574	PR01832	Vascular endothelial growth factor receptor
HMMPfam	IPR013151	357	425	PF00047	Immunoglobulin
	IPR013151	682	750	PF00047	Immunoglobulin
	IPR013098	773	860	PF07679	Immunoglobulin I-set
	IPR001245	939	1266	PF07714	Tyrosine protein kinase
HMMSmart	IPR003599	150	241	SM00409	Immunoglobulin subtype
	IPR003599	255	336	SM00409	Immunoglobulin subtype
	IPR003598	261	326	SM00408	Immunoglobulin subtype 2
	IPR003599	349	441	SM00409	Immunoglobulin subtype
	IPR003598	355	430	SM00408	Immunoglobulin subtype 2
	IPR003596	359	425	SM00406	Immunoglobulin V-set
	IPR003599	456	537	SM00409	Immunoglobulin subtype
	IPR003598	460	524	SM00408	Immunoglobulin subtype 2
	IPR003599	551	665	SM00409	Immunoglobulin subtype
	IPR003599	674	770	SM00409	Immunoglobulin subtype
	IPR003598	680	755	SM00408	Immunoglobulin subtype 2
	IPR003596	684	750	SM00406	Immunoglobulin V-set
	IPR003599	779	861	SM00409	Immunoglobulin subtype
	IPR003598	785	850	SM00408	Immunoglobulin subtype 2
	IPR001245	939	1266	SM00219	Tyrosine protein kinase
	IPR002290	939	1270	SM00220	Serine/threonine protein kinase
ProfileScan	IPR007110	144	219	PS50835	Immunoglobulin-like
	IPR007110	342	439	PS50835	Immunoglobulin-like
	IPR007110	461	516	PS50835	Immunoglobulin-like
	IPR007110	540	665	PS50835	Immunoglobulin-like
	IPR007110	668	766	PS50835	Immunoglobulin-like
	IPR007110	773	859	PS50835	Immunoglobulin-like
	IPR000719	939	1270	PS50011	Protein kinase
ScanRegExp	IPR000719	945	973	PS00107	Protein kinase
	IPR001824	998	1011	PS00240	Receptor tyrosine kinase
	IPR008266	1130	1142	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	117	WDTGVLLCALLSCLLLTGSSSG	138	PRIMARY	22
SOSUI2	2	870	ELITLTCTCVAATLFWLLLTLFI	892	PRIMARY	23