ORK11860

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11860

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11860
Clone name	hj02546
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No.X52328, AmpR). The cDNA includes the following sequence (5'GTCGACCCAC GCGTCCGCCC ACGCGTCCG3') at the 5' portion and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hj02546 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	POLG
cDNA sequence	DNA sequence (4479 bp) Predicted protein sequence (1261 aa)
Description	DNA polymerase subunit gamma-1 (EC 2.7.7.7)(Mitochondrial DNA polymerase catalytic subunit)(PolG-alpha)

Features of the cloned cDNA sequence

Description

Length: 4479 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	423 bp
Genome contig ID	gi51511731r_87560563
PolyA signal sequence (AATAAA,-13)	+--------+--------+----*----+---- AAACCTGCTCCAAGGCAGTGGAAATAAAAAGAAGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAGACTCTATCTTCTCATCAAAGCCTTTGTTAGTCATGCTTTCC

Features of the protein sequence

Description

Length: 1261 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P54098	100.0	DNA polymerase ...	Homo sapiens
BAF83970	99.9	unnamed protein...	Homo sapiens
AAM77583	99.9	polymerase (DNA...	Homo sapiens
BAA12223	99.8	mitochondrial D...	Homo sapiens
XP_523149	99.1	polymerase (DNA...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002297	149	161	PR00867	DNA-polymerase gamma A
	IPR002297	290	304	PR00867	DNA-polymerase gamma A
	IPR002297	434	443	PR00867	DNA-polymerase gamma A
	IPR002297	870	896	PR00867	DNA-polymerase gamma A
	IPR002297	972	980	PR00867	DNA-polymerase gamma A
	IPR002297	1071	1084	PR00867	DNA-polymerase gamma A
	IPR002297	1117	1133	PR00867	DNA-polymerase gamma A
	IPR002297	1170	1185	PR00867	DNA-polymerase gamma A
	IPR002297	1186	1202	PR00867	DNA-polymerase gamma A
HMMPfam	IPR001098	752	1204	PF00476	DNA-directed DNA polymerase
HMMSmart	IPR001098	893	1167	SM00482	DNA-directed DNA polymerase
ScanRegExp	IPR001098	965	984	PS00447	DNA-directed DNA polymerase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp