ORK11882M

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11882M

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11882M
Clone name	fj00226s1
Vector information	The cDNA fragment was originally inserted at XhoI-NotI site ... The cDNA fragment was originally inserted at XhoI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC(=attB1)-5' end of cDNA.
Symbol	BRD4
cDNA sequence	DNA sequence (5875 bp) Predicted protein sequence (1376 aa)
HaloTag ORF Clone	FHC11882
Flexi ORF Clone	FXC11882
Description	Bromodomain-containing protein 4 (HUNK1 protein)

Features of the cloned cDNA sequence

Description

Length: 5875 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1541 bp
Genome contig ID	gi42406306r_15108658
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- GATCATGGAATAAACACATCTCTCTTTTTTTAATG
Flanking genome sequence (99989 - 99940)	----+--------+--------+--------+--------+----* CTGGCGTCTCCCTGACATTTCTTTGTGAACCAACTGTTGCCTAGGCTAGG

Features of the protein sequence

Description

Length: 1376 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60885	100.0	Bromodomain-con...	Homo sapiens
XP_001914731	96.1	bromodomain con...	Equus caballus
NP_001094373	93.3	bromodomain con...	Rattus norvegicus
EDL40326	93.1	bromodomain con...	Mus musculus
Q9ESU6	93.0	Bromodomain-con...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001487	92	105	PR00503	Bromodomain
	IPR001487	108	124	PR00503	Bromodomain
	IPR001487	124	142	PR00503	Bromodomain
	IPR001487	435	454	PR00503	Bromodomain
HMMPfam	IPR001487	77	166	PF00439	Bromodomain
HMMPfam	IPR001487	370	459	PF00439	Bromodomain
HMMSmart	IPR001487	70	180	SM00297	Bromodomain
HMMSmart	IPR001487	364	473	SM00297	Bromodomain
ProfileScan	IPR001487	89	161	PS50014	Bromodomain
ProfileScan	IPR001487	382	454	PS50014	Bromodomain
ScanRegExp	IPR001487	94	153	PS00633	Bromodomain

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp