ORK11900

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11900

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11900
Clone name	fj19226s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	JARID2
cDNA sequence	DNA sequence (4805 bp) Predicted protein sequence (1262 aa)
Description	Protein Jumonji (Jumonji/ARID domain-containing protein 2)

Features of the cloned cDNA sequence

Description

Length: 4805 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	820 bp
Genome contig ID	gi89161210f_15254531
PolyA signal sequence (None)	+--------+--------+----*----+---- TATCAAAAAACCCTTCAATAGCATCCTTAAGATTT
Flanking genome sequence (374752 - 374801)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAGGAAAAAAAAGTGATGGAAGCCGTAAGTGC

Features of the protein sequence

Description

Length: 1262 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92833	100.0	Protein Jumonji...	Homo sapiens
XP_001169872	99.5	jumonji, AT ric...	Pan troglodytes
AAC50822	99.4	jumonji putativ...	Homo sapiens
XP_001493082	94.8	jumonji, AT ric...	Equus caballus
EDL41008	92.5	jumonji, AT ric...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003349	574	618	PF02375	Transcription factor jumonji
	IPR001606	634	744	PF01388	AT-rich interaction region
	IPR013129	932	1047	PF02373	Transcription factor jumonji
	IPR004198	1155	1209	PF02928	Zinc finger
HMMSmart	IPR003349	572	613	SM00545	Transcription factor jumonji
	IPR001606	638	730	SM00501	AT-rich interaction region
	IPR003347	900	1064	SM00558	Transcription factor jumonji/aspartyl beta-hydroxylase
ProfileScan	IPR003349	573	614	PS51183	Transcription factor jumonji
	IPR001606	637	729	PS51011	AT-rich interaction region
	IPR003347	900	1064	PS51184	Transcription factor jumonji/aspartyl beta-hydroxylase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp