Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11929
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11929
Clone name hh11475
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of th ...
Symbol SMARCC1
cDNA sequence DNA sequence (5661 bp)
Predicted protein sequence (1111 aa)
Description SWI/SNF complex subunit SMARCC1 (SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily C member 1)(SWI/SNF complex 155 kDa subunit)(BRG1-associated factor 155)
Features of the cloned cDNA sequence

Length: 5661 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2325 bp
Genome contig ID gi89161205r_47502388
PolyA signal sequence
(AATAAA,-33)
+----*----+----*----+----*----+----
TGAATAAATGGAACACCATTTCTGGAAAAAAAAAC
Flanking genome sequence
(395922 - 395873)
----+----*----+----*----+----*----+----*----+----*
TGAGCAACCCAGGGAGACCCCATCTCTACAAATAATTTAAAAATTAGCCA

Features of the protein sequence

Length: 1111 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q92922 0 100.0 SWI/SNF complex...
Homo sapiens
AAH50564 0 99.9 SWI/SNF related...
Homo sapiens
XP_001154676 0 99.7 SWI/SNF-related...
Pan troglodytes
AAC50693 0 98.4 SWI/SNF complex...
Homo sapiens
XP_533845 0 96.5 similar to SWI/...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007526 455 543 PF04433 SWIRM
IPR014778 626 671 PF00249 Myb
HMMSmart IPR000953 221 267 SM00298 Chromo
IPR001005 625 673 SM00717 SANT
ProfileScan IPR007526 455 552 PS50934 SWIRM
IPR001005 629 671 PS50090 SANT
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp